ID: 1095710969

View in Genome Browser
Species Human (GRCh38)
Location 12:45287623-45287645
Sequence GAGAATAAGGAAAAGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 674
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 611}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095710969 Original CRISPR GAGAATAAGGAAAAGGAGTC AGG Intronic
900095337 1:937907-937929 GGGAATAAGAAAAAGGAATTAGG + Intronic
900363169 1:2299700-2299722 TGCAATAAGGAAAGGGAGTCTGG - Intronic
901174296 1:7287466-7287488 GAGAAGAAGGAAAGGGAGAAAGG - Intronic
901309476 1:8257917-8257939 GAGAATCAGGAAATGCAGACGGG + Intergenic
901722741 1:11213140-11213162 GAAAATAAAGAAAATTAGTCTGG + Intronic
901783945 1:11612216-11612238 GGGAATAAGGGAAAGGGGTAGGG + Intergenic
902870569 1:19311629-19311651 GAGAGTGGGGGAAAGGAGTCAGG + Intronic
903536275 1:24068384-24068406 CAGAACAGGGAAAAGGACTCTGG - Intronic
903924841 1:26824820-26824842 GAGAAAAAAGAAAAGGTTTCAGG + Intergenic
904878753 1:33678145-33678167 GAGAATGAGCAAGAGAAGTCGGG - Intronic
905394756 1:37660066-37660088 ATGAATACGGAAAAGGAGCCTGG + Intergenic
905960622 1:42039650-42039672 GAGAATAAAGAAATGGATACTGG - Intergenic
906803089 1:48754577-48754599 GAGAAAAAGGAAAAGGGGACTGG + Intronic
907231270 1:53001272-53001294 GAGAAAAAGGGAAAGGAGGATGG + Intronic
907722606 1:56986192-56986214 GAGAAAAAGGAAGAGGATTTGGG - Intergenic
907775701 1:57512407-57512429 GAGAACAAAGAAAAGAAATCTGG + Intronic
908022778 1:59915542-59915564 GAGAATAAGGAAATAGAGACAGG + Intronic
908280650 1:62531130-62531152 GAGAATAATGATGAGGAATCTGG - Intronic
908395913 1:63725542-63725564 GAGCAGAAGGAAAAGGAGCAAGG + Intergenic
909923960 1:81416148-81416170 AGCAATAAGGAAAAGGAGACCGG - Intronic
909975926 1:82046154-82046176 GTGAAAAAGGAAGAGGAGGCAGG - Intergenic
910328909 1:86045914-86045936 GGCAGTAAGGAAAAGGATTCTGG + Intronic
910571025 1:88703063-88703085 GAGAAAAGGGACAAGGAGTGCGG - Intronic
910928135 1:92417127-92417149 GAGAAGAAGGAAAATAAGTCTGG + Intergenic
911242680 1:95483023-95483045 GAGAAGAAGGAAGAGCAGTGTGG + Intergenic
911315971 1:96357176-96357198 GAAAATAAGGAAAAGATATCTGG - Intergenic
911576570 1:99585382-99585404 TAGAATAGGGAAGAGGATTCTGG - Intergenic
911854244 1:102856602-102856624 GAAAATAAAGAAAAGGAGGGGGG - Intergenic
912423797 1:109567941-109567963 GAGAAAAAAGAGAAGGACTCAGG + Intronic
912694097 1:111827917-111827939 GAGAATAAGAGAAAAGAGTGAGG + Intronic
913077387 1:115352506-115352528 GAGAAGCAGGATAAGGAGGCTGG - Intergenic
913096387 1:115521083-115521105 TAGAATAAGGAAAATGAGTAAGG - Intergenic
913302926 1:117392038-117392060 TGGAAGTAGGAAAAGGAGTCAGG - Intronic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914261838 1:146005457-146005479 TAGAATAAGAAACAGGAGACAGG - Intergenic
914452544 1:147805601-147805623 GAGTATAAGGGAAAGAAGGCGGG + Intergenic
915046045 1:153018114-153018136 GAGAGCAAGGAAAAGCAGGCTGG + Intergenic
917172099 1:172188290-172188312 GAGCCTAAGGAAAAGAAATCTGG - Intronic
917424841 1:174902788-174902810 GAGAACAAAGAAAAGTAGTGTGG - Intronic
919052370 1:192526610-192526632 GAGAATAAGGAAGGGAAATCAGG - Intergenic
919390299 1:196975980-196976002 GAGAATAGTGAAAAAGTGTCAGG + Intergenic
919530847 1:198717801-198717823 GAGAAAAAGGGAAGGGAGTGGGG - Intronic
919678197 1:200408444-200408466 GAAAATAAGGAACAGAAGACCGG - Exonic
920540341 1:206773470-206773492 AATAACAAGGAAAAGAAGTCAGG + Intergenic
920983073 1:210856528-210856550 GAGAATGAGGAAGAAGAGGCTGG - Intronic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
923059623 1:230458902-230458924 GAGAAGGAGAAAAAGGAGTGAGG - Intergenic
923950670 1:238948915-238948937 GGGAATAAGAAAAATGACTCTGG + Intergenic
924063533 1:240200791-240200813 GAGAACATGGAAAAAGAGTTGGG - Intronic
924156015 1:241177377-241177399 GAAAATAAGGAACAGGAGCCTGG + Intronic
924163693 1:241260518-241260540 GAAGATAAGGAAAAAGAGTAAGG + Intronic
924247927 1:242103080-242103102 GAGAATTTGGAAAAGGAGATTGG + Intronic
924743723 1:246813491-246813513 GAGAATCAGCAAAGGGAGACAGG - Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062944327 10:1449152-1449174 GGCAATAAAGAAAAGGAGTGGGG - Intronic
1065101087 10:22334340-22334362 GAAAATAAGGAAAAGGAGAGAGG - Intergenic
1065583575 10:27195747-27195769 AAAAATAAGGAAAAAGAGTTTGG + Exonic
1066195817 10:33098772-33098794 GAGAAAAAGGAAATGGACTATGG - Intergenic
1068056380 10:52016869-52016891 GAGAAGAAGGAAAGGGAGGAGGG + Intronic
1068241141 10:54302114-54302136 GATAATAATGAATAGCAGTCTGG + Intronic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1069224292 10:65922640-65922662 GAGAATAAGAAAAAAAAGTTTGG - Intronic
1069374944 10:67784247-67784269 GAGAAAGAAGAAAAGGAGGCAGG + Intergenic
1069455330 10:68549500-68549522 GATAAAAAGGAAAATTAGTCTGG + Intergenic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1071075472 10:81745992-81746014 GAAAATAAGGAAAAGGTTTAGGG + Intergenic
1072047364 10:91670573-91670595 AAGAATAAAGAAAAGGATTCAGG + Intergenic
1072445712 10:95496997-95497019 GAGAGTAAGGTTAGGGAGTCTGG - Intronic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1072907144 10:99464861-99464883 GAGAATAAGGAAAAGAAATTGGG - Intergenic
1073159258 10:101375530-101375552 GAGAATAATGGCAGGGAGTCTGG + Intronic
1073868116 10:107828586-107828608 GAGCATACTCAAAAGGAGTCTGG - Intergenic
1074223368 10:111460181-111460203 TAGAAAGAGGACAAGGAGTCTGG - Intergenic
1075055648 10:119216505-119216527 GAGATGAAAGAAAGGGAGTCAGG + Intronic
1075295706 10:121273128-121273150 AAGAAGAAGGAAAAGGCCTCTGG + Intergenic
1076565783 10:131398184-131398206 GAGAAAAGGGAAAATGAGGCAGG - Intergenic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1077746249 11:4909483-4909505 GAGAATTAGAAAAAGGAAACGGG + Intronic
1077849794 11:6064370-6064392 GAGCAGAAGAAAAAGGACTCTGG + Intergenic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078155648 11:8797750-8797772 AAGAATCAGGAAAAAGAGTAGGG - Intronic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1078536988 11:12183158-12183180 AAGAAAAAAAAAAAGGAGTCAGG - Intronic
1078591256 11:12641978-12642000 GAGAATAATTAAGAGGAGGCTGG + Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080284577 11:30594719-30594741 GAGATAAATGGAAAGGAGTCTGG - Intergenic
1081346912 11:41999129-41999151 GGGAAATAGGAAAAGTAGTCTGG - Intergenic
1081352293 11:42069006-42069028 AAGAAGAAGGAAAAGAAGTGAGG + Intergenic
1082286449 11:50322921-50322943 GTGAAAGAGGAAGAGGAGTCAGG - Intergenic
1082920952 11:58493263-58493285 GAAAAAAAGAAAAAGGAGGCTGG + Intergenic
1083310657 11:61781950-61781972 CAGAATAAGGATCAGGAATCAGG + Intronic
1085007384 11:73105295-73105317 GAGAATAAGGACAATGAAACAGG + Intronic
1086879694 11:92138844-92138866 AAAAATTAGGAAAAGGAGTGAGG + Intergenic
1087224947 11:95588560-95588582 AAAAATAAGGAAAATGACTCAGG - Intergenic
1087345187 11:96963172-96963194 GAGAATGAGGAAAAAGTGTGTGG + Intergenic
1087354307 11:97074528-97074550 GAGAACAAAGAAAAGCAGTGTGG - Intergenic
1087881211 11:103418682-103418704 GAGAACAAAGAAAAGCAGTGTGG + Intronic
1088086259 11:105984267-105984289 GAGAAAATGGACAAGGAGGCAGG - Intergenic
1088296576 11:108303369-108303391 TTGAATAAGAAAAAGGAGTGGGG + Intronic
1088333082 11:108673441-108673463 GAAAAAAAGAAAAAGGAATCAGG - Intronic
1089779675 11:120864669-120864691 GAGAATGAGGAAATAGAGCCTGG - Intronic
1089828207 11:121298810-121298832 GAGAGTCAGCAAAAGGAGTTAGG + Intronic
1090864545 11:130687286-130687308 GAGAATGAGGAAAAAGAATTTGG - Intronic
1091129863 11:133136636-133136658 GAGAATAGGGAAAAGGAGAAAGG + Intronic
1091740026 12:2954464-2954486 GAAAATAAAGAATAGGAGGCCGG + Intergenic
1092237749 12:6820637-6820659 GGAAATAGGGAAAAGGAGTTGGG - Exonic
1094695091 12:32809861-32809883 GAGAATAAAGAAAAGCAGAGTGG - Intronic
1095622239 12:44271297-44271319 GAGAAGAAGGAAAAGCAGAATGG - Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1095703557 12:45215606-45215628 GAGAATAAGCAAAAGAAGAAGGG - Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095824746 12:46519461-46519483 GAGAAGAAAGAAAAAGAGGCAGG - Intergenic
1095969330 12:47891006-47891028 GAAAATAAGGAAAATAAGCCTGG - Intronic
1096546446 12:52343427-52343449 GAGAATGAGGCAAAGTGGTCTGG + Intergenic
1096565439 12:52473794-52473816 GAGAAGCAGGACAAGGAATCGGG + Intergenic
1097031716 12:56094568-56094590 GATAATAAGGAGAGGGGGTCAGG + Intronic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1097360096 12:58649990-58650012 GTGAATAAGCAAATGGAGTGGGG + Intronic
1097420505 12:59372804-59372826 GTTAAAAAGGAAAAGGAGGCCGG - Intergenic
1098024351 12:66186990-66187012 GAGGAGAAGGAATTGGAGTCGGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098441484 12:70523764-70523786 GAGAAAAAAGAAAAAGATTCTGG - Intronic
1099157900 12:79202521-79202543 AAGAAGAAAGAGAAGGAGTCAGG + Intronic
1099207638 12:79746462-79746484 CAGAATATGGAAAAGGTATCTGG + Intergenic
1099215923 12:79853389-79853411 GAGAATAAGGCAGAGGAGCTAGG - Intronic
1099570117 12:84306459-84306481 GAGAGAGAGGAAAAGGGGTCAGG + Intergenic
1099846376 12:88033207-88033229 GAGAATAAGGAAAAGAAAAAAGG - Intronic
1100078373 12:90816917-90816939 GTGAATAATAAAAATGAGTCAGG - Intergenic
1100360248 12:93870920-93870942 GACAACAATTAAAAGGAGTCTGG + Intronic
1100535307 12:95503396-95503418 GAGAACAAGAAAAATGAGTATGG + Intronic
1100561908 12:95755542-95755564 GAGTATAAGCAAAAGGATTTTGG - Intronic
1100778116 12:97994544-97994566 GAGAGAAAGAAAAAGGAGCCTGG - Intergenic
1101438293 12:104682927-104682949 GAGAAGAAGGACAGAGAGTCAGG - Intronic
1101551947 12:105771444-105771466 GAGAAGGAGGAAAAGGACTTTGG + Intergenic
1101829014 12:108242787-108242809 TTGAATAAGGAAAAAGAGTGGGG - Intronic
1101908585 12:108846118-108846140 GAGAGAAAGGCAGAGGAGTCAGG + Intronic
1102536761 12:113587697-113587719 AAGGAGAAGGAAAAGGAGTGGGG - Intergenic
1102591525 12:113959878-113959900 GAGAAGAAGAAAAAGGTGGCAGG - Exonic
1103341568 12:120223871-120223893 GAGAAAAAGGAACAGGGGCCAGG + Intronic
1103781338 12:123400708-123400730 GAGAAGATGGGTAAGGAGTCTGG - Intronic
1104036900 12:125104038-125104060 GAGATTAAGGAAATGGATTATGG + Intronic
1104091474 12:125521320-125521342 TGGAATAAGGAAAAGGAGAAGGG - Intronic
1104253803 12:127122667-127122689 GAGAATATGTAAAATGAGGCTGG + Intergenic
1104547153 12:129722720-129722742 GAAAAAAAGAAAAAGGAGCCAGG - Intronic
1104782783 12:131432554-131432576 GAGAATGAGGAGGAGGAGTTGGG + Intergenic
1105887437 13:24653714-24653736 CAGCATAAGGAAAAGAACTCTGG - Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1107131388 13:36900067-36900089 GAGTAGAAGGAAAAGAAGGCAGG - Intronic
1107976438 13:45693071-45693093 GAGAAAAAGGCAAAGGACTGTGG + Intergenic
1107986805 13:45783290-45783312 GAGAAGAATAAAAAGGAGTCTGG + Exonic
1108230554 13:48335738-48335760 GAAAATTATGAAAAGGACTCAGG - Intronic
1108560467 13:51638256-51638278 GAGAAGGATGAAAAGGAGTAAGG + Intronic
1108770067 13:53688832-53688854 GGGAAAAAGGAGAAGGAGACAGG + Intergenic
1108951858 13:56104484-56104506 AAGAATAAGGAAACAGTGTCAGG + Intergenic
1109226896 13:59707929-59707951 GAGAATAATGAAATGAAGTGGGG - Intronic
1109412787 13:61995308-61995330 GAAACTAAGGAAAATGATTCTGG - Intergenic
1109773103 13:67003078-67003100 GAGACTGAGGAAAATGGGTCTGG - Intronic
1110220471 13:73067529-73067551 GAGAATATGGAAAAGCTGTTGGG + Intronic
1110420677 13:75304331-75304353 GAGAATAAAGCAAGGCAGTCAGG + Intronic
1110554819 13:76847634-76847656 GAAAATCAGGCAAAGGAGACAGG - Intergenic
1111906420 13:94260976-94260998 GAAAATAAGGAAAAGGCGCCGGG + Intronic
1112393295 13:99004313-99004335 GAGAACAAGGAAAAGACCTCAGG + Intronic
1112404611 13:99107889-99107911 GAGAAAGAGGAAAAGGAGGAAGG + Intergenic
1112444374 13:99450845-99450867 GAGAATGAGGGATAGGAGACAGG - Intergenic
1112449485 13:99495881-99495903 AAAAACAAGGAAAAGGACTCAGG + Intergenic
1112604005 13:100885916-100885938 GAGAATAGGCAAAAGTAGTCAGG + Intergenic
1113659563 13:112096304-112096326 TACAATTAGGAAAAGGAGACAGG + Intergenic
1114356248 14:21912380-21912402 CTGATTAGGGAAAAGGAGTCAGG + Intergenic
1115002182 14:28436222-28436244 TAGAATAAGGACAAGAATTCAGG + Intergenic
1115204590 14:30888268-30888290 GAGAGTCAGGAAAAGGAGACTGG + Intronic
1115507686 14:34108672-34108694 GTGAATAAAGAAACGCAGTCTGG - Intronic
1115593605 14:34887709-34887731 GAGAAAAATGAAAAGAAGTTCGG - Intergenic
1115722807 14:36181697-36181719 GTCAATGAGGAAAAGGAGACTGG + Intergenic
1116370474 14:44124338-44124360 AACAATATGGAATAGGAGTCAGG - Intergenic
1116676436 14:47911905-47911927 GACAATAAGGAAGAGGGGTGAGG - Intergenic
1118073407 14:62271158-62271180 GGGAGTAAGGAAAAGGAGAGAGG - Intergenic
1118205599 14:63720324-63720346 GAGAAAAAGGAAAAGAAGGATGG + Intronic
1119345029 14:73916170-73916192 AGGAAGGAGGAAAAGGAGTCTGG + Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119760335 14:77146324-77146346 GAGAAGAGAGAAAAGGAGACAGG + Intronic
1120095692 14:80385334-80385356 GAGAATGAGGAAAGAGGGTCAGG - Intronic
1120153336 14:81063244-81063266 GAGACTAAGGAAGAGTAGCCAGG - Intronic
1120175704 14:81291096-81291118 GAGAAAAAAGGAAAGGAGACAGG + Intronic
1120250875 14:82060998-82061020 GAGAATCAGCAAAGGGAGACAGG + Intergenic
1120398787 14:84002175-84002197 GAGAATGAGGAAGAGAAGACTGG - Intergenic
1120649137 14:87110012-87110034 AAAAATTAGGAAGAGGAGTCAGG - Intergenic
1121552895 14:94815565-94815587 AAGCATAAGGAAAAGGAGCGAGG - Intergenic
1122613894 14:103003605-103003627 GAGAATAAGGAACCGCAGTGGGG - Intronic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1123894590 15:24816006-24816028 GGGAATAAGGCAAAGGAGAAGGG - Intergenic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1124203043 15:27694763-27694785 GAGAAAAAGGAAAAGGGGCGGGG - Intergenic
1124382781 15:29180915-29180937 GAGAAAAAGAAAAAGGAATTTGG + Intronic
1124845686 15:33287809-33287831 GAGAATGAGGAAAATGATCCAGG - Intergenic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1125157583 15:36606380-36606402 GAGAATAAGGGAATGAAGTTTGG + Intronic
1125725798 15:41867524-41867546 GACAAGAAGGTAATGGAGTCAGG - Exonic
1126371004 15:47947070-47947092 AAAAATAAGGAAAAGGAGAAAGG + Intergenic
1127012008 15:54641805-54641827 GAGAATGAGGAAAAGCAGACTGG + Intergenic
1127285848 15:57533067-57533089 AAGAATACGGAAAAGCAGCCAGG - Intronic
1127291797 15:57578055-57578077 GAGGAACAGGAGAAGGAGTCAGG - Intergenic
1128120061 15:65139150-65139172 GAGTTTAGGGAAAAGGAGTGGGG + Intergenic
1128281990 15:66403358-66403380 GAGAATAAAGAAAAGTTGTGGGG + Intronic
1130022231 15:80241304-80241326 GAAAAGAAGGAACAGGAGGCAGG - Intergenic
1130214005 15:81951611-81951633 GAGAACTAGGCTAAGGAGTCTGG - Intergenic
1130355866 15:83129875-83129897 GAGAATAAGGCAGAGGAACCAGG - Exonic
1130686532 15:86042460-86042482 GAGAAAAAGGACAAGGTGTCTGG - Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1130759250 15:86800815-86800837 GAGAATAAAGAAATGGAGACTGG + Intronic
1130857365 15:87852640-87852662 GAGAGCAAGGATAAAGAGTCTGG - Intergenic
1131210802 15:90494237-90494259 GAAAATAAGGAAAAAGAAACAGG - Intronic
1131718540 15:95141281-95141303 GAGAATCAGAAAACAGAGTCTGG - Intergenic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1133036069 16:3035131-3035153 GAGGACAAGGGAAGGGAGTCAGG - Intronic
1133326527 16:4945396-4945418 GAGAAGAAGAAAAAGGAATGTGG - Intronic
1134208208 16:12254478-12254500 GAAAATACGAAAAATGAGTCAGG + Intronic
1135014869 16:18916881-18916903 TAGGATAAGGAACAAGAGTCAGG + Intronic
1135064732 16:19299926-19299948 AAGAATAAGGAAAGGGGGCCAGG + Intronic
1135197929 16:20409827-20409849 GAGACTGAGGAAAAGGACTGGGG + Intronic
1135209860 16:20515977-20515999 CAGAGTCTGGAAAAGGAGTCTGG + Intergenic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135582574 16:23641102-23641124 GAGGAGAAGGAAAAGGTGCCGGG - Exonic
1135805740 16:25540859-25540881 AAAAAGAAGGAAAAGGATTCTGG + Intergenic
1135853103 16:25982403-25982425 GAGACTGAGGCAAAAGAGTCGGG - Intronic
1136061461 16:27729514-27729536 GAGAAAAAGAAAAAGGACTTAGG - Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137910232 16:52370573-52370595 AAGAATAAGGAAATGCAGACAGG - Intergenic
1138164982 16:54792881-54792903 GAGAATAAGAAAAAAGTGTCAGG + Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1139084633 16:63569726-63569748 GGGAATAAAGAAAAGGAGGCAGG + Intergenic
1139422383 16:66856652-66856674 GTGAATAAGGGAAAGGACTTAGG - Intronic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1140347175 16:74225216-74225238 GATAAGAAGGAAAAGAAGACAGG + Intergenic
1142667107 17:1469487-1469509 GAGGATGAGGAAGTGGAGTCAGG - Intronic
1143403432 17:6660410-6660432 GAGGCTAAGGTAGAGGAGTCAGG + Intergenic
1143569062 17:7743155-7743177 GAGTATAGGGAAAAGGGGCCAGG - Intronic
1143772640 17:9178454-9178476 GAGAATTAGGAAGAGGAGGGAGG - Intronic
1143875544 17:9988035-9988057 GAGCAGAAGGAAATGGACTCTGG + Intronic
1144031720 17:11329127-11329149 GGGAATAAAGAAAAGGTGGCAGG + Intronic
1144163364 17:12583054-12583076 GAGAATGACGACAAGGGGTCAGG - Intergenic
1144457432 17:15430607-15430629 GAGAAGAAGGGAAAGGAGGGAGG + Intergenic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1145828559 17:27896680-27896702 GAGAATAAGTAAAAGTAGAAGGG + Intergenic
1146184898 17:30718333-30718355 GAGACGAAGGAGAAGGTGTCGGG + Intergenic
1146308468 17:31748821-31748843 GAGGTTGAGGAAAAGGAGTAGGG + Intergenic
1146664317 17:34687153-34687175 GACAATAAGGAAAAGAACCCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149114165 17:53071729-53071751 GAGAAGAAGAAAAAGGAGGGAGG + Intergenic
1149274859 17:55022320-55022342 GAGAATGAAGGAAAGGAGTAGGG - Intronic
1149364687 17:55931223-55931245 GATAATAATGAAAAAGAGACAGG - Intergenic
1149615988 17:57999322-57999344 GAGAATTGGGAACAGGAGTTAGG - Intronic
1149632229 17:58135859-58135881 TTGAATAAGGAAAAGTAATCTGG + Intergenic
1150156144 17:62855056-62855078 GAGACAAATTAAAAGGAGTCAGG + Intergenic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151591626 17:75047867-75047889 GAGAATATGGAGAAGGGGTGTGG - Intronic
1152985254 18:315176-315198 GAGAATGAAGAGAATGAGTCTGG + Intergenic
1153449799 18:5214461-5214483 GGAGATAAGGCAAAGGAGTCAGG - Intergenic
1153682644 18:7515051-7515073 GAAAAAAAGGAAAAGGGGTGGGG - Intergenic
1153973779 18:10248848-10248870 GAGAATATGGAAAATGATGCAGG + Intergenic
1155035673 18:22022930-22022952 AAGAAAAAGGGAAAGAAGTCGGG + Intergenic
1155420888 18:25654805-25654827 TAGAATAAGAATAGGGAGTCAGG - Intergenic
1155774591 18:29744387-29744409 AAGAATACAGAAATGGAGTCAGG + Intergenic
1156233683 18:35180252-35180274 GAGAAAAAGGAAGAAGGGTCGGG - Intergenic
1156487487 18:37475769-37475791 GAGAACAGGGAAAATGTGTCTGG - Intronic
1156489582 18:37488229-37488251 GGGAAACAGGAAAAGGGGTCAGG - Intronic
1156575443 18:38309855-38309877 CAGAATAAAGAAAAGCAGTAAGG + Intergenic
1156768551 18:40689647-40689669 GAGAATAATGAAGGGGAGACAGG - Intergenic
1156787678 18:40935176-40935198 AAGAATGAGGAAAAGAAGTCAGG + Intergenic
1157106647 18:44780300-44780322 CAGGATCAGGAAGAGGAGTCAGG - Intronic
1157140529 18:45101510-45101532 GAGATTAAGGTAAATGAGGCTGG - Intergenic
1158182346 18:54730660-54730682 GAGAGTGAGGAGGAGGAGTCAGG - Intronic
1158245812 18:55430983-55431005 AAGCAAAGGGAAAAGGAGTCAGG + Intronic
1159031795 18:63239221-63239243 GAGTATAAAGAAAGGGAGGCTGG + Intronic
1159927381 18:74281445-74281467 GAGAAGTGGGAAAAGGAGACAGG + Intronic
1159998872 18:74996465-74996487 TAGAAAAAGGAAATGAAGTCAGG + Intronic
1160804418 19:985741-985763 GAGAACCAGGAAGAGGAGTCGGG - Intronic
1163531333 19:17850819-17850841 GAGAATAAGTAAGAGGAGATTGG + Intergenic
1163872009 19:19830097-19830119 GAGAAGAAGGAAGAGCAGTGTGG + Intergenic
1163886274 19:19967317-19967339 GAGAGGAAGGAAAAGCAGTGTGG - Intergenic
1163888193 19:19988167-19988189 GAGAAGAAGGAAAAGCAATGTGG + Intergenic
1164234935 19:23323582-23323604 GAAAAGAAGGAAAAGGAGGATGG - Intronic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164462065 19:28457471-28457493 GGGAGGAAGGAAAAGGGGTCAGG - Intergenic
1165066308 19:33230845-33230867 GAGAACAGGGAAAATGAGGCAGG - Intergenic
1166398882 19:42463162-42463184 GATAATAGGGAAGAGGAGGCAGG + Intergenic
1167067453 19:47197208-47197230 GGGAATAAGAAAAAGAAGGCAGG - Intronic
1167837302 19:52084803-52084825 AAGAAGAAAGAAAAGGAGCCAGG - Exonic
1167846357 19:52168074-52168096 AAGAGGAAAGAAAAGGAGTCAGG - Exonic
1167880956 19:52456924-52456946 AAGAGGAAAGAAAAGGAGTCAGG + Exonic
1167958349 19:53086278-53086300 AAGAGGAAAGAAAAGGAGTCAGG - Exonic
1167969923 19:53182900-53182922 AAGAGGAAGGCAAAGGAGTCAGG - Exonic
1168673051 19:58255959-58255981 GAGAAAAAGGAAAAGGACTAAGG + Intronic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925220267 2:2133798-2133820 GAGAGTCAGGAAAAGTAGCCTGG - Intronic
925357425 2:3251968-3251990 GAGATTAAGGTAAAGGTATCTGG - Intronic
926934315 2:18072066-18072088 GAGAGAAAGGAAAAGGAACCAGG - Intronic
927353078 2:22141597-22141619 GAGGAGAAGGAAAAGGAAACAGG + Intergenic
927790054 2:26002718-26002740 TGGAGTGAGGAAAAGGAGTCTGG + Intergenic
928700226 2:33891520-33891542 GAGGATAAGGAAAATAAGTATGG + Intergenic
929405468 2:41636971-41636993 GAGAGTAAGGAAGAGCAGTGTGG + Intergenic
929951509 2:46413453-46413475 GGTAATAAGGAAAAGGAGGCTGG + Intergenic
930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG + Intronic
930289480 2:49475581-49475603 AACAATAAGCAAAAGGAGTTTGG + Intergenic
930662452 2:54068425-54068447 GGGAATAAAGAAAATCAGTCTGG + Intronic
931813948 2:65881679-65881701 GAGAAGCAAGAAAAGGAGTGAGG + Intergenic
931868197 2:66433808-66433830 GAGAATAAAGAGAAGGGGTGAGG + Intronic
932432531 2:71684550-71684572 GAGAGTAAGGAAAAGTACTGTGG + Intronic
933129391 2:78654683-78654705 GAGAAGAAGGAAGAGCAGTGTGG + Intergenic
933204474 2:79489656-79489678 TAGAATAAGCAAAATGAGCCAGG - Intronic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934684749 2:96312769-96312791 CTAATTAAGGAAAAGGAGTCAGG + Intergenic
936589081 2:113785724-113785746 CAGAAGAAGGAAAAGGAGTGAGG - Intergenic
936750516 2:115635482-115635504 GAGAGTAAGGAAAAGCAGAGTGG - Intronic
937116939 2:119413341-119413363 GTGAATAAGGCAGAGGACTCTGG - Intergenic
937734087 2:125268622-125268644 GTGATAAAGGAAAAGGAGACAGG - Intergenic
938250631 2:129813045-129813067 GTGAATGGGGATAAGGAGTCTGG - Intergenic
938412454 2:131076130-131076152 GAGAATGAGAAAAAAGAGGCTGG - Intronic
939749570 2:146026522-146026544 GAGAAGATGGAAGAGGAGACAGG - Intergenic
940291923 2:152085467-152085489 GAGGAAAAAGAAAAGCAGTCAGG + Intronic
940904970 2:159160922-159160944 GAGAGGAAGGAAAAGGGGTGGGG - Intronic
941483251 2:166044961-166044983 GAGAATTAGAAAATGGACTCAGG - Intronic
941483885 2:166054020-166054042 AAGAAGAAAGAAAAGGGGTCAGG + Intronic
942253619 2:174069467-174069489 GAAAAAAAAGAAAAAGAGTCAGG - Intergenic
942582194 2:177430642-177430664 GAGAACAAAGAAAAGGAGGGTGG - Intronic
942909523 2:181226383-181226405 GAGAAGGTGGAAAAGGAGGCAGG - Intergenic
942995937 2:182260354-182260376 GAGATTATGTAAAAGGAGTCAGG - Intronic
944527592 2:200635777-200635799 GAGAGTAAGGGAAATGAGGCAGG + Intronic
946225457 2:218261928-218261950 GAGGAGAGGGAAGAGGAGTCTGG - Intronic
947091052 2:226511891-226511913 AAGAATAGAGAAAAGGAGTGAGG - Intergenic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
947434430 2:230060726-230060748 GAGGATAAGGAGCAGGAGTCGGG + Intronic
947698544 2:232213373-232213395 AAGGACATGGAAAAGGAGTCAGG + Intronic
947830271 2:233134657-233134679 GAGAATAAGGAACCAGAGACTGG + Intronic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
948568443 2:238901270-238901292 GAGCAAAAGGCAAAGGAGGCCGG - Intronic
948781315 2:240323571-240323593 GAGGTGGAGGAAAAGGAGTCTGG + Intergenic
1169949621 20:11029027-11029049 GAGTATAAGAAAAAGGAGAAAGG - Intronic
1170311474 20:14997151-14997173 AAGGAGAAGGAAAAGGAGTGGGG + Intronic
1170463866 20:16605076-16605098 GAGAATAAAGAAGAGGAGAAGGG + Intergenic
1170875766 20:20248563-20248585 GAGGAGAAGGAACAGGAGGCAGG + Intronic
1171094619 20:22319493-22319515 GAGAAAGAGGAAAAGGAGGAGGG + Intergenic
1171463368 20:25311289-25311311 GAGAAAAAGGGAGAGGAGTCAGG + Intronic
1172488670 20:35316630-35316652 AAGAAAAAGGAAATGGACTCAGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172643162 20:36453972-36453994 AAGAAAAAGAAAAAAGAGTCCGG + Intronic
1173735182 20:45355989-45356011 GGGAATCAGGAACAGGAATCAGG - Intergenic
1174045656 20:47730815-47730837 AAGAATAAGGAAAAGCATACTGG - Intronic
1174723880 20:52841045-52841067 AAGAATAAGGAAGAGGAGAGGGG - Intergenic
1174847472 20:53956921-53956943 CAGAATAAAGACATGGAGTCGGG - Intronic
1176522830 21:7837870-7837892 GAGAATGAAGAAAAGCAGGCTGG + Intergenic
1176723167 21:10409608-10409630 GAGAATAAGGTAATGAAATCAGG + Intergenic
1177372343 21:20220208-20220230 GTGTTTAAGGAAAAGGAGTTGGG - Intergenic
1178656850 21:34467882-34467904 GAGAATGAAGAAAAGCAGGCTGG + Intergenic
1178820588 21:35971568-35971590 GAGAGTAAGGAAAATGTGTCAGG + Intronic
1178996485 21:37405341-37405363 AAGAATTAGGAAAAGGATGCAGG - Intronic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1179781233 21:43702274-43702296 GAGAATGGGGAAAAGAAGACAGG + Intergenic
1180304324 22:11062343-11062365 GAGAATAAGGTAATGAAATCAGG + Intergenic
1181517252 22:23422080-23422102 GAGCAAAAGGAAGAGGAGTGGGG - Intergenic
1182185833 22:28401171-28401193 GAGGAGAAGGAAAAGGAGGGGGG + Intronic
1182505053 22:30776090-30776112 AAGAAAAAGAAAAATGAGTCTGG - Intronic
1183173429 22:36204585-36204607 GAGAATAAGGAGATGGAGGGAGG + Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1183312607 22:37118967-37118989 GGGAAAAAGGAAAAGGAGAAAGG - Intergenic
1184883682 22:47328828-47328850 GAGAAAAAGGAAAAGGAAAGAGG - Intergenic
1184958750 22:47913125-47913147 GAGGATATGGAAAAGGATTTCGG + Intergenic
1185166004 22:49262603-49262625 GAGAGTAAGAAAAAGTAGGCTGG + Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
949141529 3:639387-639409 GGGAATAAGGAAAAGGAGTGTGG - Intergenic
950231105 3:11276616-11276638 GATAAGAAGGAAAAGTGGTCAGG - Intronic
950793935 3:15495332-15495354 GAGACTGAGGAAATGAAGTCTGG + Intronic
951155351 3:19346337-19346359 GAGAATGAGACAAAGGAGACAGG + Intronic
951251376 3:20397748-20397770 GAGTATAAGAAAAAGGAGGTTGG + Intergenic
951373807 3:21888437-21888459 GAGAATAGTAAAAAGGGGTCAGG + Intronic
952303047 3:32121245-32121267 GAAAAGAAGGAAGAGGAGACAGG - Intronic
952503890 3:33989735-33989757 GAGAAGAAGGAAGAGCAGTGTGG - Intergenic
952635343 3:35522632-35522654 GAGAATGAGGCAGAGGAGGCAGG - Intergenic
952948472 3:38497525-38497547 GATTATAAGGAAAAGGAGAGCGG - Intronic
953115717 3:39990269-39990291 GAGAAGAAGGAAGAGTAGTGTGG - Intronic
953559458 3:43974599-43974621 GAAAATAAGTAAGAAGAGTCAGG - Intergenic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956392355 3:68786956-68786978 GAGAAAAAATAAAAAGAGTCAGG + Intronic
956642244 3:71426199-71426221 AAGAATCAGGCAAAGGAGTCAGG + Intronic
956720429 3:72112829-72112851 GAACAAAAAGAAAAGGAGTCTGG - Intergenic
956871069 3:73418704-73418726 GAGAACAAGAAAATGAAGTCAGG - Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
958015487 3:87935249-87935271 GAGAAAAAGGAGAGGGAGTGTGG + Intergenic
958720495 3:97837452-97837474 GAGAACAGGGAAAAAGAATCAGG - Intronic
959554285 3:107698961-107698983 GTGAACAAGGAAAAGGACTATGG + Intronic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960164286 3:114384292-114384314 GGGAAAAAGGAAAAGGGGGCTGG + Intronic
960179515 3:114558816-114558838 GTGAATAAGGAAAAGTATACTGG - Intronic
960268061 3:115644000-115644022 CAGATTAAGGAAAAGCAATCAGG - Intronic
960428970 3:117545503-117545525 GAGAGGAAGGGAAAGGAGTAAGG + Intergenic
960798354 3:121512506-121512528 AAGAAAAAGGAAAAGGTATCTGG - Intronic
961112349 3:124295835-124295857 GACAAGAAGGAAAAGAAGACAGG - Intronic
961770964 3:129249725-129249747 GACAAGAAGGATGAGGAGTCAGG + Exonic
962159758 3:132986638-132986660 GGGAATAAAGAAAAGAAATCAGG + Intergenic
962266960 3:133950667-133950689 GAGAGCAAGGAAGAGAAGTCTGG - Intronic
962383168 3:134912981-134913003 GAAAATAAGGCAAAGGACTGTGG + Intronic
962658119 3:137570338-137570360 GAAAATGAAGAAAAGGAGTAAGG - Intergenic
962842835 3:139251426-139251448 GAGGAGAAGGAAATGGAGTTGGG - Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963531291 3:146476242-146476264 GAGAGTAAGGAAATGCAGTGTGG + Intronic
963619359 3:147586194-147586216 GAAAATAAGAAAACGGAGACAGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964384914 3:156137277-156137299 AGGGATAAGGAAAAGGAATCAGG + Intronic
964461888 3:156941258-156941280 GGGAATAAGCACAAGGGGTCTGG - Intronic
964878403 3:161395789-161395811 GAAAACAAGGAGAAGGAGCCAGG + Intergenic
965116683 3:164499470-164499492 GAGAATGAGAAAAAGGCTTCTGG - Intergenic
965691588 3:171362817-171362839 GAGTATAATGAAAAGGACTTTGG - Intronic
965906455 3:173713221-173713243 AAGAATAAAGAAAAGGAGTTAGG + Intronic
966326637 3:178763380-178763402 GAAAATGAGGCAAAGGAGTTAGG + Intronic
966507482 3:180723016-180723038 GAGAACAGGGAAAAGGAATTAGG - Intronic
966648543 3:182273543-182273565 GAAAATAAGTAGAAGGACTCAGG + Intergenic
967216310 3:187213387-187213409 GATAATAAGGAAAAAGAACCAGG - Intergenic
967664799 3:192158294-192158316 GAGAAAAGGGAAAAGCAGGCAGG - Intronic
967735093 3:192943361-192943383 GAGACTTAGAAAAAGGAGGCTGG + Intergenic
968893459 4:3385055-3385077 GGGACCAAGGAAAAGGAGCCAGG - Intronic
970166840 4:13247537-13247559 GAGAAAAAGGGAAAGGAGAATGG - Intergenic
970270172 4:14338155-14338177 GAGAATGAAGAAAAGGACACTGG + Intergenic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
971335787 4:25722933-25722955 GAGAAAAAGGAATAGGAGAAGGG + Intergenic
971547337 4:27903038-27903060 GTGAATGAGGAAAATGAGTGGGG + Intergenic
971723838 4:30282667-30282689 GCAAATAAGGAAAAGGATTTTGG - Intergenic
972243351 4:37218086-37218108 GAGAATATTAACAAGGAGTCTGG - Intergenic
972377507 4:38486299-38486321 GAGAGAGAGGAAAAGGAGTGAGG + Intergenic
973008063 4:45037949-45037971 GAGAATAAGGAAAAAGAGATGGG - Intergenic
974181315 4:58387202-58387224 GAGAGGAAGGAAGAGTAGTCTGG - Intergenic
974640127 4:64619030-64619052 AATATTAAGGAAAAGGAGTAAGG - Intergenic
975461634 4:74660036-74660058 GAGAATGAGAAACAGGAGTGAGG + Intergenic
975648591 4:76569459-76569481 CAGAATGAGGAAGAGAAGTCAGG + Intronic
975858705 4:78652813-78652835 GTGAATAAGGAAAATGATGCAGG - Intergenic
976078014 4:81321320-81321342 GAGAGTAAGGAAAAGCAGGGTGG + Intergenic
976378878 4:84376873-84376895 GACGAGGAGGAAAAGGAGTCAGG + Intergenic
976756628 4:88505336-88505358 GAGAATAAGGAGAGAGAGCCAGG - Intronic
976989792 4:91352154-91352176 GAGAATAATCTAAAGTAGTCAGG - Intronic
977066932 4:92329965-92329987 GAGAAAAAGGAAGAGGAGTATGG + Intronic
977094487 4:92722436-92722458 GAGAATGAGGAAAAGGGGAACGG + Intronic
977242017 4:94584222-94584244 GAGAAAAAGGAACATGAATCTGG - Intronic
977318240 4:95478308-95478330 AAGAATAAGGACAAGGATTGGGG + Intronic
978174810 4:105717000-105717022 GAGAATAAGGAACTGGATTTTGG + Intronic
978359133 4:107909547-107909569 GAGAAGAAAGAAAAGGCATCTGG - Intronic
978637917 4:110832905-110832927 GAGAAGAAGAAAGAGGAGGCAGG + Intergenic
978844638 4:113258194-113258216 GAGAAAAAGGAAAGGGAGGAAGG - Intronic
979255518 4:118604035-118604057 GATATTAGGGAAAAGAAGTCAGG + Intergenic
979732910 4:124045813-124045835 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
979897751 4:126181092-126181114 GAGAATGAGGAAGATGAGACTGG - Intergenic
980184551 4:129445961-129445983 GAGAAGAAGGAAGAGCAGTGTGG + Intergenic
980553975 4:134378731-134378753 AAGAAAAAGAAAAAGGTGTCTGG + Intergenic
982123363 4:152162888-152162910 GAGGATAAGGAAGAGGAGAAAGG + Intergenic
982171359 4:152664907-152664929 CAGGAGAATGAAAAGGAGTCAGG - Intronic
982462107 4:155683654-155683676 GAAAATTATGAAAAAGAGTCTGG + Intronic
982495976 4:156092441-156092463 GAGAAAAAGGATATGGTGTCAGG + Intergenic
982936500 4:161484232-161484254 GAGAATAAGAAAAAGAAGGAAGG - Intronic
983460901 4:168024921-168024943 CAAATTAGGGAAAAGGAGTCAGG + Intergenic
983758908 4:171380290-171380312 GAAAATGAGGGAAATGAGTCTGG + Intergenic
983932990 4:173473622-173473644 GTGCATAAGGAAAAAGAGGCAGG + Intergenic
984001429 4:174251457-174251479 GAGAAAAGGGAAAAGGAGGGTGG + Intronic
984587747 4:181582272-181582294 GAGAAAAAGAAAAAGGAGCAGGG + Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
984921924 4:184772417-184772439 GAGTATAAGGAAAAGGCATATGG + Intronic
985115515 4:186586247-186586269 GAGAACAAAAAAATGGAGTCTGG + Intergenic
985958433 5:3281748-3281770 GGGAAGAAGGAAAAGGAAGCAGG + Intergenic
986278658 5:6304545-6304567 GAGGAAAAGAAAAAGGAGACGGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986996405 5:13612258-13612280 GGGAACAAGAACAAGGAGTCAGG + Intergenic
987552504 5:19402322-19402344 GAGAAAAATGAAAAGGATACTGG + Intergenic
987736081 5:21845470-21845492 GAGAATGAGGACAAGAAGTTTGG - Intronic
987941163 5:24539619-24539641 GAGAAAAAGATAAAGAAGTCAGG + Intronic
988181021 5:27793875-27793897 TAGAAAAAAGAAAAGGAGTTAGG + Intergenic
988186493 5:27870926-27870948 GAGAGTAAGGAAAAGCAGGATGG + Intergenic
988257304 5:28837082-28837104 GAGTCTAAGGAACAGAAGTCTGG - Intergenic
988602210 5:32650246-32650268 GTGAATAAGGCAAAGTAGGCAGG - Intergenic
988839268 5:35067057-35067079 GAGGATAAGAAAAAAGAGGCCGG - Intronic
989660351 5:43791241-43791263 GAGAATGAAGAATAGGAGTATGG - Intergenic
989705994 5:44331424-44331446 GAGAAAGAGGAAAAGGAAACTGG + Intronic
990173254 5:53078917-53078939 GAGAAGAAAAAAAATGAGTCTGG + Intronic
990514078 5:56516027-56516049 GAGCATACAGAAAAGGAATCAGG - Intronic
990791447 5:59484524-59484546 GAAAATAAGGAAATGAGGTCTGG - Intronic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
991990225 5:72330867-72330889 GAGAACAAGGGAAAGAAGTGGGG - Intronic
993525294 5:88957959-88957981 GAGAATAAAGAAAAGAAAGCAGG - Intergenic
993728686 5:91397272-91397294 GAGCCTTAGGACAAGGAGTCTGG - Intergenic
994521619 5:100845013-100845035 GAGAATAAGGCAAAAGACTTGGG - Intronic
995052131 5:107719115-107719137 GAGAGTAAGGAAAAGCAGGATGG + Intergenic
995736808 5:115310459-115310481 GAGAAGCAGGAAAAGTGGTCAGG - Intergenic
995753918 5:115481676-115481698 GACAATGAGGCAAAGAAGTCTGG + Intergenic
996401539 5:123068656-123068678 GAGAATACAGAAAAGGGTTCTGG + Intergenic
996445031 5:123537949-123537971 TAGACTGAGGAAAAGAAGTCAGG - Intronic
996832841 5:127758824-127758846 GAGGACAAGGAAAGGGACTCTGG + Intergenic
998558521 5:143149243-143149265 GAGAATTAGAAAAAGAAGTGTGG + Intronic
998999900 5:147909057-147909079 GAGACCAAGGCAATGGAGTCTGG - Intergenic
999089308 5:148921372-148921394 GAGAAGGAGGAAAAGGAGGATGG + Intergenic
999706340 5:154275774-154275796 GAGAACAAGGAAAATGTGCCTGG + Intronic
999877140 5:155820083-155820105 GAGAATAGGGAAAACCAGTTGGG + Intergenic
1000073002 5:157758400-157758422 GATAATAAAGAAAAGGGGACCGG - Exonic
1000256463 5:159543412-159543434 GAAAATAAAGAGAAGGAGTGGGG + Intergenic
1000267494 5:159651683-159651705 GAGAATATAGAAAATGAGACAGG - Intergenic
1000482496 5:161796630-161796652 GAAAAAAAGGAAAATGAGTGTGG + Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1001282837 5:170400145-170400167 AAGAATATGGCATAGGAGTCAGG - Intronic
1001711460 5:173781968-173781990 GAGAAGAAAGAAGATGAGTCAGG + Intergenic
1002847780 6:963307-963329 GAGAAGATGGAAAAGGAGAGAGG + Intergenic
1002854305 6:1023702-1023724 CTGCAGAAGGAAAAGGAGTCTGG - Intergenic
1003655404 6:8002587-8002609 GAGAAGAAAGAAAAGGGGTAGGG + Intronic
1003695159 6:8398511-8398533 GAGAAGAAGCAAAGGGAATCTGG - Intergenic
1003777885 6:9389882-9389904 GAGAAGATGAAAAAGGAGGCAGG + Intergenic
1003846932 6:10183390-10183412 AAGAACAAGGAAAAGTAATCAGG + Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004839357 6:19565177-19565199 GAGAAGAAGGAAAAGTTCTCTGG + Intergenic
1005425783 6:25701338-25701360 GAGCAAAAGGCAAAGCAGTCTGG - Exonic
1006021918 6:31122367-31122389 GAGACTCAGGAAAGGGAGCCTGG - Intronic
1006781623 6:36636358-36636380 GAGAAGAAGGAAAAGAGATCTGG + Intergenic
1007295852 6:40819971-40819993 GAAAAAAAGGGAAAGGAGTAGGG + Intergenic
1007427943 6:41759362-41759384 GAGAACAAGGCAAAGGAGCATGG - Intergenic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1008373795 6:50768307-50768329 GAGAAAAAAGAAAAGGAGAGAGG - Intronic
1009702245 6:67200140-67200162 TAGAATAAGAAAAAAAAGTCTGG - Intergenic
1009763638 6:68039793-68039815 GACAATAAGGAAAATGACTTTGG - Intergenic
1009957304 6:70471325-70471347 GGGGATAATGAAAAGGAGTAGGG + Intronic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1011004264 6:82625998-82626020 GAGAAAAAGGAAAAAGGCTCAGG - Intergenic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1011831379 6:91375821-91375843 GAGAATACAGAAAAGAAGTTAGG + Intergenic
1011838062 6:91458366-91458388 GAGAAAAAGGAAAAAGAATAAGG + Intergenic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1013304685 6:108837511-108837533 GAGAAACAGAAAAAGGAGACAGG + Intergenic
1013829831 6:114258155-114258177 GTGAATAAGGAAAGGCAGTTGGG - Intronic
1014044865 6:116874329-116874351 GAGAAACAGGAAAGGGAGTAGGG + Intergenic
1014740236 6:125140719-125140741 GAGAAAAAGGAGAGGGAGACAGG + Intronic
1015984594 6:138872495-138872517 GAGAAGCAGAAAGAGGAGTCTGG - Intronic
1016058916 6:139607950-139607972 GAGAATTGGGAAAAGGAGGAAGG - Intergenic
1016899175 6:149084042-149084064 GGGCAGAAGGAAAAGAAGTCAGG + Intergenic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017274557 6:152551079-152551101 TAGAGGAAGGAAAAGGTGTCAGG - Intronic
1017351528 6:153448275-153448297 GAGAATCATGTGAAGGAGTCTGG - Intergenic
1017674021 6:156795329-156795351 GAGAATAAGGGAAGGGAGGCCGG + Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018448744 6:163884966-163884988 GAGAATCAGAAAAACCAGTCGGG + Intergenic
1020415583 7:7942094-7942116 ATGAATGATGAAAAGGAGTCAGG - Intronic
1020775757 7:12451692-12451714 GACAATGAGGAAGAGGAGCCAGG - Intergenic
1020779159 7:12496439-12496461 GAGAAGAAGGGAAAGGAGTTTGG - Intergenic
1020929858 7:14379463-14379485 GAGAATAAGGAAAGAGAGTGGGG + Intronic
1021075035 7:16292578-16292600 GAGAAAATTTAAAAGGAGTCTGG - Intronic
1021877335 7:25060945-25060967 GAGAAAGAGGGAAGGGAGTCTGG - Intergenic
1021923763 7:25514705-25514727 GAGAGTAAGGAGAATGAGTTTGG - Intergenic
1022553996 7:31273185-31273207 GACAAGAAGGATAAGGAGTGGGG - Intergenic
1022845786 7:34208450-34208472 GAGAAGAAGGAAAAGAAGGTAGG - Intergenic
1022923836 7:35040839-35040861 GATAATAAGGTATAGGAATCAGG + Intergenic
1024896336 7:54266064-54266086 GAAAATGAGGATAAGAAGTCAGG + Intergenic
1025190510 7:56892351-56892373 GAGACTCAGGAATATGAGTCAGG - Intergenic
1025681430 7:63684569-63684591 GAGACTCAGGAATATGAGTCAGG + Intergenic
1026524473 7:71142350-71142372 AGGAAGAAGGAAATGGAGTCTGG - Intronic
1027527831 7:79293201-79293223 GTGAATGATAAAAAGGAGTCAGG - Intronic
1027738840 7:81973565-81973587 GAGGAGAAGGAAAAGGAGGGAGG + Intronic
1028261366 7:88670328-88670350 AGGAAGAAGGAAAAGGAGCCTGG - Intergenic
1028455262 7:91031532-91031554 GAGAATAATGAACATGATTCAGG + Intronic
1028791083 7:94853715-94853737 GATATTAAGTAAAATGAGTCAGG - Intergenic
1028837794 7:95394268-95394290 GACAATAAGGAAAGGGAGGGAGG + Intronic
1029015137 7:97308433-97308455 GAAAGTAAGGAAGAGGAGTCAGG - Intergenic
1029666412 7:101997934-101997956 GAGACTCAGGAATATGAGTCAGG - Intronic
1030085165 7:105809765-105809787 GAAAAAAAAAAAAAGGAGTCTGG - Intronic
1030641300 7:112009774-112009796 GAGAAAAAGGAAAGGGATTAAGG + Intronic
1030645670 7:112058741-112058763 AAGAAAAAGGAAAAAGAATCTGG + Intronic
1030925917 7:115454400-115454422 AAGAACAAGGAAAGGGAGCCAGG + Intergenic
1032298883 7:130668631-130668653 GACAAGAAGGACGAGGAGTCTGG - Exonic
1032662326 7:133998594-133998616 AAGAATAAGGCACAGGAGACAGG + Intronic
1033714165 7:143982157-143982179 CAGAACAAGGATCAGGAGTCAGG - Intergenic
1034643581 7:152624569-152624591 CAAAAGAAGGAAAAGAAGTCTGG + Intergenic
1034672082 7:152866666-152866688 GAGAAAAAGGGAAGGGAGGCCGG - Intergenic
1035852699 8:2936794-2936816 GTGGAAAAGGAAAAGCAGTCAGG - Intronic
1036288225 8:7463212-7463234 AAGGATAAGAAAATGGAGTCGGG + Intronic
1036333250 8:7848316-7848338 AAGGATAAGAAAATGGAGTCGGG - Intronic
1038064542 8:23950179-23950201 GAAAATAACAAAAAGGATTCAGG - Intergenic
1038781169 8:30569313-30569335 GAGGAGAAGGAAAAGGTCTCAGG + Intronic
1039009049 8:33073270-33073292 GAGAGTCAGAAACAGGAGTCTGG + Intergenic
1039011005 8:33092742-33092764 GGGAAGAAGGAAATGGACTCTGG + Intergenic
1039208666 8:35186190-35186212 GGGCAGAAGGAAGAGGAGTCAGG + Intergenic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1039503567 8:38035204-38035226 AATAATAATAAAAAGGAGTCTGG - Intronic
1039658143 8:39433116-39433138 GAGAAAAAGGAAGAAGAGTGTGG + Intergenic
1039867605 8:41518867-41518889 GAGAGTAAGGAACAGGAATGAGG + Intergenic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1041211940 8:55560216-55560238 GAGAAGAAGGAAGAGCAGTGTGG - Intergenic
1041369634 8:57145000-57145022 GAGAATCAAGAGAAGGAGACAGG + Intergenic
1041972831 8:63761993-63762015 GACAATGAGGAAAAGCAGTGTGG - Intergenic
1042001672 8:64129753-64129775 GTGAATGAGGAAAAGGCATCTGG - Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042345195 8:67719828-67719850 GAGAATAAGGAAAGGGGGCAGGG + Intronic
1042855399 8:73261745-73261767 GAGCATTAGGAAACGTAGTCAGG + Intergenic
1044327093 8:90870640-90870662 GAGAATTGGCAAAAGGTGTCCGG - Intronic
1044642301 8:94396073-94396095 AAGAAGAAGGAAAAAGAGTAAGG + Intronic
1044688030 8:94846568-94846590 AAGAATAAGTAAAAAGAGGCTGG - Intronic
1044830120 8:96239009-96239031 AAGAATAAGGAAAAGGAAAGTGG - Intergenic
1045116493 8:98988579-98988601 GAGAATAAAGGACAGGAGCCTGG - Intergenic
1045743448 8:105388317-105388339 GAGAAAAGGGAAAAGGAGATGGG + Intronic
1045913159 8:107434303-107434325 ATGAAACAGGAAAAGGAGTCTGG + Intronic
1046085376 8:109427654-109427676 GAGAATGGGGGAAAGGAGTCAGG + Intronic
1046837761 8:118821901-118821923 GTAGATAAGGAAATGGAGTCAGG + Intergenic
1046906843 8:119582608-119582630 GAAAATTAAGAAAAGGAGGCAGG + Intronic
1046918826 8:119705872-119705894 GAGAATAAGGATATGATGTCTGG - Intergenic
1047518696 8:125577831-125577853 TAGAAAAAGGAAGAGAAGTCTGG - Intergenic
1049123746 8:140766464-140766486 GGTAATGAGGAAAATGAGTCAGG - Intronic
1050126675 9:2363179-2363201 GAGAAGAAAGAAAAGGTGTGAGG + Intergenic
1051093489 9:13437688-13437710 TTGCATAAGGAAGAGGAGTCAGG - Intergenic
1051281964 9:15450559-15450581 TAGATTAAGGAAAAGAACTCAGG + Intronic
1052595768 9:30556648-30556670 AAGAACAAGGAAAATGAGTGAGG + Intergenic
1053056210 9:34994399-34994421 GAGAATAGGAAAAGGGAGTTGGG - Intronic
1055436047 9:76293252-76293274 AAGAAAAAGTAAAAGGAGTGTGG + Intronic
1055977446 9:81968844-81968866 GAGAAGAAAGAAAAGGAGAAGGG + Intergenic
1056071243 9:82989079-82989101 GAGAATCAGGAAATGGACTTTGG - Intronic
1056575593 9:87853851-87853873 GAGAATATGGAAGTTGAGTCTGG + Intergenic
1057910985 9:99020593-99020615 GAGAATCAGGAAAAGGGCACTGG + Intronic
1059067157 9:111097408-111097430 GTGAAGAAGGGAAAGGAGGCTGG - Intergenic
1060049108 9:120364537-120364559 GAGAAAAAGGAAAAGAAATCAGG + Intergenic
1060200404 9:121649044-121649066 AGGAAGAAGGAAAAGGAGCCTGG + Intronic
1060779866 9:126403432-126403454 GAGAAGAAGGAAAACGACGCAGG - Intronic
1060890818 9:127186979-127187001 GACAGACAGGAAAAGGAGTCAGG + Intronic
1062744610 9:138203433-138203455 GAGAATTAGGAAGAGGAGGAGGG + Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185853788 X:3513361-3513383 GAGAATGAGGCAAAGGAGTCTGG + Intergenic
1186788035 X:12971585-12971607 GAGAAGAAGGAAGAGGAGGGAGG - Intergenic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1188047082 X:25438231-25438253 GGGAATAAGGAAGATGAGTCTGG - Intergenic
1188269297 X:28118878-28118900 GGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1188811172 X:34656363-34656385 GAGAGGAAGGAAAAAGAGTGGGG + Intronic
1189613239 X:42759405-42759427 GAGAATTATAGAAAGGAGTCAGG + Intergenic
1189789349 X:44588639-44588661 AAAAAAAAGGAAAAGGAATCTGG - Intergenic
1189805636 X:44732973-44732995 AAGAATAACAAAAAGTAGTCAGG - Intergenic
1189986103 X:46554653-46554675 TAGAAAATGGAAAAGGAGTCTGG + Intergenic
1190082298 X:47366056-47366078 GAGAAGAGGGGAAAGGAGTCAGG - Intergenic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1192544791 X:72004517-72004539 GGGAGTAAGGAAAAGCAGTGAGG + Intergenic
1192817379 X:74608671-74608693 GAGAAAAACTAAAAGGACTCAGG + Intronic
1193164432 X:78264621-78264643 GAGAATGAGGAAAAGCAGGGTGG - Intergenic
1193182930 X:78480045-78480067 GCTAATAAGGGAAAGGAGTCAGG - Intergenic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1193859717 X:86650360-86650382 GAGAAGAAGGAAAAGACTTCAGG - Intronic
1194183027 X:90737185-90737207 GAGAGTAAGGAAAAGCAGGGTGG + Intergenic
1194423732 X:93710122-93710144 AAGAAGAAGAAAAAGAAGTCTGG + Exonic
1194996418 X:100596025-100596047 AAGATTAAGGCAAAGGAGGCGGG + Intronic
1195069642 X:101266782-101266804 GAGAATAAGGAGAAAGAATGAGG - Intergenic
1195177634 X:102326442-102326464 GAAAGTAAAGAAAAGGAGTTGGG - Intronic
1195181230 X:102360651-102360673 GAAAGTAAAGAAAAGGAGTTGGG + Intronic
1195491306 X:105473104-105473126 GAGACTACAGAATAGGAGTCAGG + Intronic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1196599821 X:117589426-117589448 GAGAATGAGGAAAAGCAGGGTGG + Intergenic
1197687076 X:129451997-129452019 GAGAATAAAAAAATGGAGGCTGG - Intronic
1197793855 X:130280775-130280797 GAAAACAAGGAAAAGGACTCAGG - Intergenic
1198302771 X:135347582-135347604 GAGAAAAAGGAAGAGGACTCTGG - Intronic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199093021 X:143713262-143713284 GAGAATAAGGAGAATGGGACTGG - Intronic
1199147885 X:144392798-144392820 GATAATGAGGAAAAGAAGACAGG - Intergenic
1199248812 X:145636942-145636964 GAGAATAAAGAAAACAAGACAGG + Intergenic
1199901535 X:152177361-152177383 GAGGATAAGGATAAGAAGTGAGG + Intronic
1200375483 X:155775281-155775303 GAGAAAAAGTAAAAGCAGACAGG - Exonic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200529645 Y:4319139-4319161 GAGAGTAAGGAAAAGCAGGGTGG + Intergenic
1200809665 Y:7471163-7471185 GAGAATGAGGCAAAGGACTCTGG - Intergenic
1201942440 Y:19474326-19474348 GAGGAGAAGGGAAAGGAGTGTGG + Intergenic
1202039165 Y:20664802-20664824 GAGAATAAGGGAATGGAGCTGGG - Intergenic