ID: 1095712241

View in Genome Browser
Species Human (GRCh38)
Location 12:45302755-45302777
Sequence CATTAGGCTCATTTGGAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095712235_1095712241 12 Left 1095712235 12:45302720-45302742 CCTTGTGCAAAATATCCTTAGTA 0: 1
1: 0
2: 0
3: 13
4: 158
Right 1095712241 12:45302755-45302777 CATTAGGCTCATTTGGAGGGCGG 0: 1
1: 0
2: 1
3: 17
4: 111
1095712236_1095712241 -3 Left 1095712236 12:45302735-45302757 CCTTAGTAAATAGATTTTTACAT 0: 1
1: 0
2: 2
3: 40
4: 475
Right 1095712241 12:45302755-45302777 CATTAGGCTCATTTGGAGGGCGG 0: 1
1: 0
2: 1
3: 17
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095712241 Original CRISPR CATTAGGCTCATTTGGAGGG CGG Intronic
906244712 1:44264808-44264830 TATTAGGCTAATTAGGAGGAAGG - Intronic
906283004 1:44566703-44566725 CATTACCCTAATTTGGAGGGCGG + Intronic
907665620 1:56431697-56431719 CATCAGGCTAATATGGAGGGTGG + Intergenic
911811826 1:102292692-102292714 CATTGGGGTCTTTTGGAGGGTGG - Intergenic
923077325 1:230621627-230621649 CATGAGGCTCAGTTGGATGTTGG - Intergenic
924889919 1:248264685-248264707 CATTTTGTTCATTTGGAAGGGGG + Intergenic
1068346045 10:55779632-55779654 CATCAGGATTTTTTGGAGGGTGG + Intergenic
1068852568 10:61760587-61760609 CATCTGGGCCATTTGGAGGGTGG + Intronic
1072728885 10:97831521-97831543 CATTAGGAGCAGATGGAGGGAGG + Intergenic
1073055776 10:100700212-100700234 TATTACTCTCATTTGGTGGGTGG - Intergenic
1074114347 10:110444295-110444317 CCTTAGGCCCTTTTGGAAGGAGG - Intergenic
1075353721 10:121751088-121751110 CTTTAAGCCCATTTGGTGGGAGG + Intronic
1076109542 10:127850341-127850363 CATTCGGCCCCTCTGGAGGGTGG - Intergenic
1081056213 11:38413532-38413554 CATTTGGCTCATTTGGGCAGTGG - Intergenic
1083337924 11:61937462-61937484 CATCTGGCTAATTTGGTGGGGGG + Intergenic
1091071986 11:132574766-132574788 CATTAGACTCATTTGGCCTGTGG + Intronic
1091197756 11:133746681-133746703 CATGAGGCTCCTTGGGAGGCAGG - Intergenic
1092193767 12:6537095-6537117 CTGTAGGCTCATTTGCAGGGGGG + Exonic
1093554515 12:20454632-20454654 CATTAGGGTCTATTGGAGGCTGG - Intronic
1095712241 12:45302755-45302777 CATTAGGCTCATTTGGAGGGCGG + Intronic
1097979586 12:65724284-65724306 CCTTAGGATGATTTGAAGGGAGG - Intergenic
1099829706 12:87825981-87826003 CACTAGGGTCCTTTGGAAGGTGG + Intergenic
1102077895 12:110074359-110074381 CCTGAGGCTCATCTGGTGGGTGG - Intergenic
1108967206 13:56323741-56323763 CACTGGGTACATTTGGAGGGTGG + Intergenic
1109242835 13:59911959-59911981 CTTAAGGCTTATTAGGAGGGAGG - Intronic
1111191262 13:84810230-84810252 TATTAGGGCCTTTTGGAGGGTGG + Intergenic
1116107808 14:40533068-40533090 CACTGGGATCTTTTGGAGGGCGG + Intergenic
1118878287 14:69803507-69803529 CATGAGGCTCTGTTGGGGGGCGG - Intergenic
1118917607 14:70121135-70121157 CCATAGGCTCATTTTGGGGGGGG - Intronic
1125591651 15:40857950-40857972 AATTCTGCTCATTTGGAGGTTGG + Exonic
1126399342 15:48253347-48253369 CCTGAGGCTAAGTTGGAGGGTGG - Intronic
1128753840 15:70167665-70167687 TATGAGGCTCATTTGGAAAGTGG + Intergenic
1130933376 15:88448826-88448848 CATTAGGCACATTTCTGGGGTGG - Intergenic
1137979652 16:53058783-53058805 CATTAGATTAAGTTGGAGGGTGG - Intronic
1139705113 16:68736062-68736084 CATTATTCCCATTAGGAGGGTGG + Intergenic
1144950332 17:18990451-18990473 CATTAGGCTCCTTTCCAGGGTGG - Intronic
1150326907 17:64264564-64264586 CATTAGAATCACCTGGAGGGAGG - Intergenic
1158098341 18:53801035-53801057 CATTGGGGCCTTTTGGAGGGTGG - Intergenic
1161014762 19:1978179-1978201 CAGTGGTGTCATTTGGAGGGTGG + Intronic
1162208020 19:9070503-9070525 CACTGGGCTTATTTGGTGGGGGG - Intergenic
1163434684 19:17288423-17288445 CATTAGGCGGATCTGGTGGGTGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1166120369 19:40682791-40682813 CTTTCGGCCCATCTGGAGGGAGG + Exonic
1168088053 19:54062986-54063008 CATCAGGTTCAATTGGAGGATGG + Intronic
925435217 2:3831176-3831198 CTTTAGGATCATTTGGAAGAGGG - Intronic
925636130 2:5942741-5942763 CCTTAGGTCCATTTGGAGGGTGG - Intergenic
926717825 2:15939100-15939122 CCTTAGGCTTGTTTGGAGAGAGG - Intergenic
927417723 2:22896343-22896365 TATTAAGCCCATTTGGTGGGGGG - Intergenic
929428989 2:41870994-41871016 CTTGAGGCTCATTTGGAGGCTGG - Intergenic
929776511 2:44934012-44934034 CATTAGCTTTATTTGGTGGGGGG - Intergenic
930241406 2:48939147-48939169 GATGAGGCTTATTTGGAAGGAGG + Intergenic
930957675 2:57222967-57222989 CACTAGGGCCTTTTGGAGGGTGG - Intergenic
931912890 2:66921563-66921585 TATTAGTATCATTTGGTGGGAGG + Intergenic
932703696 2:74007535-74007557 CCTTAGACTCATTTAGAGTGTGG + Intronic
933616991 2:84492247-84492269 CAGTAGGCACATTTGAAGGTGGG - Intergenic
934847852 2:97673873-97673895 CATTATGATCTTTAGGAGGGTGG + Intergenic
936701055 2:115012104-115012126 CATTCAGCTCATGTGGAGGACGG - Intronic
940392842 2:153152571-153152593 CACTAGGACCTTTTGGAGGGTGG - Intergenic
940563910 2:155336594-155336616 CCTTAGGTTAATTTGGAGAGAGG - Intergenic
944110991 2:196131020-196131042 CATAAGGGTCAATTGGTGGGTGG + Intergenic
945604412 2:211910559-211910581 CATTGGGGTCTTTTGCAGGGTGG + Intronic
947940612 2:234051710-234051732 CATGGGGCTCATTTGGAGGTAGG + Intronic
1168856763 20:1014141-1014163 CCTTTGGCTCCTTGGGAGGGAGG - Intergenic
1169193056 20:3669819-3669841 CATGAGGCTCACTTGGAGCCTGG - Intronic
1170493469 20:16901442-16901464 AATTAATCCCATTTGGAGGGAGG + Intergenic
1173269293 20:41517263-41517285 CACTAGGGCCTTTTGGAGGGTGG + Intronic
1175482526 20:59321592-59321614 CAAAAGGCTTATTGGGAGGGGGG + Intronic
1175542410 20:59755975-59755997 CATCAGGGTTGTTTGGAGGGTGG + Intronic
1176139394 20:63538353-63538375 CAGTAGGGTCAGTGGGAGGGTGG - Intergenic
1177285046 21:19039011-19039033 CACTGGGGTCTTTTGGAGGGTGG - Intergenic
1183015141 22:34980078-34980100 CCTTAAGTTCATTTGGATGGTGG - Intergenic
1183674217 22:39290786-39290808 CCTTGGGCACCTTTGGAGGGAGG - Intergenic
949379217 3:3426361-3426383 CATTAGGGCCTATTGGAGGGTGG - Intergenic
950718816 3:14868181-14868203 CATTAGACTCATTGTCAGGGAGG - Intronic
951398118 3:22196007-22196029 CATTGGGGTCTTTTCGAGGGTGG + Intronic
953325976 3:42013204-42013226 CCTTAGGCTTAAATGGAGGGAGG - Intergenic
953531094 3:43740488-43740510 CCTTAGGCTCATCTGGAGGATGG + Intergenic
956760672 3:72441115-72441137 CATTTAGCTCATTTGGTTGGGGG - Intronic
956958653 3:74372207-74372229 CATTTTGCTAATTTGGAGGAGGG - Intronic
958983148 3:100748444-100748466 GATTAGGCCCACTTGGAGGAGGG - Exonic
962481072 3:135799332-135799354 CATTTTTCTCATCTGGAGGGTGG - Intergenic
967514311 3:190348822-190348844 CACTGGGGTCTTTTGGAGGGTGG - Intronic
969682076 4:8648946-8648968 CATTAGGCAGATGTGGATGGGGG + Intergenic
972040630 4:34591723-34591745 CAATAGGGACTTTTGGAGGGTGG + Intergenic
972245233 4:37240137-37240159 CATTACGCAGATTTGGAAGGGGG + Intergenic
973139374 4:46747211-46747233 CACTAGGGTCTTTTGGAGGGTGG - Intronic
974665653 4:64957632-64957654 CCTTAGGTTCATTTGCAGTGTGG - Intergenic
978293263 4:107171964-107171986 CATTGGGGCCTTTTGGAGGGTGG - Intronic
978911141 4:114065472-114065494 CACTGGGGTCTTTTGGAGGGTGG - Intergenic
980971425 4:139570868-139570890 AATTAGGCTAATTTGGAGGAAGG + Intronic
985092407 4:186377825-186377847 CATTGGGGCCTTTTGGAGGGTGG - Intergenic
994718326 5:103350507-103350529 CACTAGGGTCTTTTGGAGGGTGG + Intergenic
994795262 5:104290988-104291010 CACTGGGCCCTTTTGGAGGGTGG - Intergenic
995239038 5:109865018-109865040 CATTCTGCTCATTTGCAGGTGGG + Exonic
995832563 5:116370070-116370092 CCTCAGGCTCATTTTGAGTGTGG + Intronic
999566500 5:152868322-152868344 CAAGATGGTCATTTGGAGGGAGG - Intergenic
1000349587 5:160342911-160342933 CATTAGAGTCACTTGGTGGGTGG + Intronic
1004027457 6:11833114-11833136 CATCATGGTCATTTGTAGGGAGG - Intergenic
1004285970 6:14321121-14321143 AAATAGCCTCATTTGGTGGGAGG - Intergenic
1005413549 6:25576641-25576663 CATTAACCTCATTTGGGGGATGG - Intronic
1007027223 6:38588450-38588472 GATTAGGCCCAGTTGGAGGAGGG - Intronic
1007109629 6:39305428-39305450 CATAAAGCTCAGTGGGAGGGAGG + Intronic
1007333575 6:41134703-41134725 CACTAGGGTCGTTTGGAGGTTGG - Intergenic
1008725821 6:54417544-54417566 CACTAGGGCCTTTTGGAGGGTGG - Intergenic
1013393226 6:109708146-109708168 CACTGGGGTCTTTTGGAGGGTGG - Intronic
1015193183 6:130494322-130494344 CATTAGGGAAATTTGGAGGGTGG - Intergenic
1016200464 6:141401216-141401238 CACCAGGTTGATTTGGAGGGTGG - Intergenic
1019851948 7:3568314-3568336 CATTATTTTCATCTGGAGGGAGG - Intronic
1031453689 7:121953830-121953852 CATTAGGTTCAGATGGTGGGTGG - Intronic
1031457920 7:122007229-122007251 CATTAGGCTTATTTGGTTTGTGG + Intronic
1031721201 7:125179132-125179154 CATTAGGTCCTTTTGGAGGGTGG + Intergenic
1038605798 8:29002471-29002493 CAGAAGGATCATTTGGAGGTTGG + Intronic
1046441674 8:114263111-114263133 GATTTGGATCATTGGGAGGGTGG - Intergenic
1046838222 8:118826804-118826826 CATTTGGCTCATGTGGAGGAAGG - Intergenic
1047692157 8:127366841-127366863 CATTTAGCTCATTTTGAGGCTGG - Intergenic
1048007462 8:130431133-130431155 CATGGGGATCATTTGGAGGGGGG - Intronic
1049930565 9:452292-452314 CATCAGGATCACCTGGAGGGCGG - Intronic
1051918460 9:22235427-22235449 CATTGGGGTCTTTTGGAGGATGG + Intergenic
1056383136 9:86073841-86073863 CATTAGACTCATGTGGCTGGTGG + Intronic
1057907420 9:98993557-98993579 CTTTAGTCTCATTTGCAGGGAGG + Intronic
1058500597 9:105611506-105611528 CAATGGGTTCTTTTGGAGGGTGG - Intronic
1062376155 9:136262805-136262827 CAGCAGGCTCACCTGGAGGGTGG - Intergenic
1185820018 X:3193860-3193882 CACTGGGGTCTTTTGGAGGGAGG + Intergenic
1186199736 X:7145046-7145068 CTGTAGCCTCATTTGGTGGGTGG - Intronic
1186957541 X:14699962-14699984 CACTGGGGTCTTTTGGAGGGTGG + Intronic
1186984519 X:14997357-14997379 CATTTGGCTCATTTGGATGGCGG + Intergenic
1193762379 X:85483393-85483415 CACTGGGGTCTTTTGGAGGGTGG - Intergenic
1195462401 X:105142511-105142533 CATTAGGCACATGCGGTGGGAGG + Intronic
1197597552 X:128484330-128484352 CACTAGGACCTTTTGGAGGGAGG - Intergenic
1200380974 X:155836919-155836941 CATTGGGGCCTTTTGGAGGGTGG + Intergenic