ID: 1095712277

View in Genome Browser
Species Human (GRCh38)
Location 12:45303157-45303179
Sequence GCAATCTGCTAGTACACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 54}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095712277_1095712278 -3 Left 1095712277 12:45303157-45303179 CCTGTGGTGTACTAGCAGATTGC 0: 1
1: 0
2: 0
3: 3
4: 54
Right 1095712278 12:45303177-45303199 TGCCTACTGTGAAAATCACCTGG 0: 1
1: 0
2: 3
3: 4
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095712277 Original CRISPR GCAATCTGCTAGTACACCAC AGG (reversed) Intronic
903729240 1:25478363-25478385 GCAATCTGCTAATTGACCAAAGG - Intronic
906574537 1:46875912-46875934 TCAAACTGCTAGTACAGCACGGG + Intergenic
906597438 1:47091993-47092015 TCAAACTGCTATTACAGCACGGG - Intronic
908663572 1:66464550-66464572 GCCATCTGCTATGACATCACAGG - Intergenic
908873914 1:68647943-68647965 TCATTCTGCTAGTATTCCACTGG - Intergenic
914332172 1:146682566-146682588 GCAATGGGCCAGAACACCACCGG - Intergenic
918337342 1:183531103-183531125 GCAATGTTCTAGTTCAACACTGG - Intronic
919142317 1:193588367-193588389 GCCATCTGCTGGTGCACCAGGGG + Intergenic
1063215913 10:3925349-3925371 GCCATCTGCATGTACAACACAGG - Intergenic
1065573330 10:27094526-27094548 GCTATCTCATAGGACACCACTGG + Intronic
1095712277 12:45303157-45303179 GCAATCTGCTAGTACACCACAGG - Intronic
1099666056 12:85630892-85630914 CCAATTTGCTAGCACACCACTGG - Intergenic
1107891027 13:44914552-44914574 GCAAACTTCTAGAAGACCACAGG - Intergenic
1120943474 14:89971688-89971710 GCAACCTGCTAGTGCTCCCCTGG + Intronic
1130782974 15:87064552-87064574 GCTATGTGCTAGTACATCATAGG - Intergenic
1137245067 16:46696137-46696159 GCAAGCTGCTAGAGCAGCACTGG - Intronic
1140001379 16:71028352-71028374 GCAATGGGCCAGAACACCACCGG + Intronic
1143497745 17:7322122-7322144 GCCATCTGCCATTACACCTCAGG + Intronic
1148903327 17:50894925-50894947 GCATACTTCCAGTACACCACGGG - Intergenic
1155589012 18:27403202-27403224 GTAATCTGCTCATACATCACAGG - Intergenic
1160976590 19:1795948-1795970 GCCATCTGCCTGTACACCAAGGG - Exonic
1168362628 19:55755128-55755150 GCATTCTGGTACTACACCTCTGG + Intergenic
928911640 2:36427780-36427802 GCAATCTGTCTGTACACCAAGGG - Intronic
931622087 2:64220829-64220851 GTGATCTTCTAGTACACCACAGG - Intergenic
933001752 2:76933636-76933658 GGAAATTGCTAGTACACCAGTGG - Intronic
938840149 2:135152808-135152830 GGACTCTACTAGTACATCACTGG + Intronic
941326792 2:164125542-164125564 AACATTTGCTAGTACACCACTGG + Intergenic
1178472675 21:32907385-32907407 GCCATCTGCAAGCCCACCACTGG - Intergenic
1178779506 21:35588053-35588075 GGAAACTGCTAGAAAACCACAGG - Intronic
1182303373 22:29351310-29351332 GCAATCTGCTGGAACACTCCTGG + Intronic
949700250 3:6748029-6748051 GCATTGTTCTAGTAGACCACTGG - Intergenic
957612610 3:82487781-82487803 TCAACCTGCTACTATACCACTGG + Intergenic
965920360 3:173905909-173905931 TCAATCTCCTAGTATACTACAGG - Intronic
966099346 3:176247467-176247489 GAAATCTGATAGTCCAACACGGG + Intergenic
974148050 4:57970010-57970032 GCAATGTTCTTGTACTCCACAGG + Intergenic
974446377 4:61988340-61988362 AAACTCTGCTAGTAGACCACAGG + Intronic
977379622 4:96255759-96255781 GGAATCTGGTAGTAGACAACTGG + Intergenic
977910566 4:102530272-102530294 GCACACTGGTAGTACACAACAGG - Intronic
983210303 4:164951859-164951881 GCACCCTGCTAGTTCAGCACAGG + Intergenic
992214332 5:74510581-74510603 GCAGCCTCCTAGTACACTACCGG + Intergenic
993983682 5:94572024-94572046 GCACACTACTAGCACACCACAGG - Intronic
993993689 5:94692233-94692255 GCAAGCTGCTACTACAGCATGGG + Exonic
996090665 5:119348543-119348565 GCAATCTCCTATCACATCACCGG - Intronic
1003175183 6:3748981-3749003 GCAATCTGCTTTTACATTACTGG + Intronic
1011270484 6:85573778-85573800 AAAATCTGGTAGTACACCCCAGG + Intronic
1017000983 6:149997159-149997181 GAAATATGCTAGTACAGTACAGG - Intergenic
1037755462 8:21707273-21707295 GCCATCTCCGAGTTCACCACAGG + Intronic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1041992582 8:64012246-64012268 TGAATCTGTTAGTACACCAATGG + Intergenic
1056825143 9:89872062-89872084 GAAAGCTCCTACTACACCACAGG - Intergenic
1058662991 9:107283304-107283326 GGAATCCGCTAGCTCACCACAGG - Exonic
1185623309 X:1466458-1466480 GCCACCAGCGAGTACACCACGGG + Exonic
1185848987 X:3467813-3467835 GCAGTCTGCTGGAACACAACTGG - Intergenic
1187364466 X:18655172-18655194 ACAGTGTGCTAGTACCCCACAGG + Intronic
1196402194 X:115328561-115328583 GTAATCTGTTAGTACATCATAGG - Intergenic
1198681450 X:139186949-139186971 GGCATCTGCTATTACAGCACTGG + Intronic
1198848391 X:140938491-140938513 GCACTCTGCTAGCATGCCACAGG + Intergenic
1201923718 Y:19262034-19262056 GTAATCTGCCAGTCCTCCACAGG + Intergenic