ID: 1095716815

View in Genome Browser
Species Human (GRCh38)
Location 12:45355414-45355436
Sequence CTGTATTTAAAGAGCTGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095716815_1095716818 -2 Left 1095716815 12:45355414-45355436 CCTGACCAGCTCTTTAAATACAG 0: 1
1: 0
2: 0
3: 14
4: 132
Right 1095716818 12:45355435-45355457 AGCAGGATTTTTTTTATTATTGG 0: 1
1: 0
2: 6
3: 53
4: 592
1095716815_1095716821 12 Left 1095716815 12:45355414-45355436 CCTGACCAGCTCTTTAAATACAG 0: 1
1: 0
2: 0
3: 14
4: 132
Right 1095716821 12:45355449-45355471 TATTATTGGGAGCTTGGACCAGG 0: 1
1: 0
2: 0
3: 7
4: 103
1095716815_1095716820 6 Left 1095716815 12:45355414-45355436 CCTGACCAGCTCTTTAAATACAG 0: 1
1: 0
2: 0
3: 14
4: 132
Right 1095716820 12:45355443-45355465 TTTTTTTATTATTGGGAGCTTGG 0: 1
1: 0
2: 2
3: 71
4: 1513
1095716815_1095716819 -1 Left 1095716815 12:45355414-45355436 CCTGACCAGCTCTTTAAATACAG 0: 1
1: 0
2: 0
3: 14
4: 132
Right 1095716819 12:45355436-45355458 GCAGGATTTTTTTTATTATTGGG 0: 1
1: 1
2: 11
3: 97
4: 802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095716815 Original CRISPR CTGTATTTAAAGAGCTGGTC AGG (reversed) Intronic
900118140 1:1037224-1037246 CTGGATTTAAAGAGGTGCTCAGG + Intronic
914352820 1:146855077-146855099 CTGTGGTTAAGGAGGTGGTCAGG - Intergenic
914934270 1:151964537-151964559 CTGGTGTTACAGAGCTGGTCTGG + Intergenic
917349251 1:174059544-174059566 TTGTATTTAAAGAGCTGTTGTGG - Intergenic
917849231 1:179046353-179046375 TTGTATATAAAGAGATGGCCGGG + Intronic
918961521 1:191283559-191283581 GTGTATTTAGAGAGTTGGTTGGG - Intergenic
920201476 1:204262304-204262326 CTGCAGTTGCAGAGCTGGTCAGG - Intronic
920685792 1:208108151-208108173 CTGAATTGAGAGAGTTGGTCAGG - Intronic
1064695832 10:17964345-17964367 CTGTAATTGAAGAGCTTGGCAGG - Intronic
1070431879 10:76348483-76348505 CTGTTTTTAATGAGTTGTTCTGG + Intronic
1070963293 10:80514310-80514332 CTGCATTTAAAGAGGTGGGATGG + Intronic
1071830655 10:89368846-89368868 GTGTAGTTAAAGTGATGGTCTGG - Intronic
1072014566 10:91334192-91334214 CTGTATTTAAAGTGGAGGTTTGG - Intergenic
1072393450 10:95013977-95013999 CAGTATTGGAAGATCTGGTCAGG - Intergenic
1073406936 10:103306530-103306552 CTGTATTTCCAGTGCTGCTCTGG + Intronic
1074067558 10:110030950-110030972 CTGTTTTCAAGAAGCTGGTCAGG - Intronic
1077003584 11:338365-338387 CTGTATTAAAAGTTCTAGTCGGG - Intergenic
1078165778 11:8883140-8883162 CTGTATTCTAAGAGCTGTTCAGG - Intronic
1080901598 11:36498189-36498211 CTGTATTTAAAATGCTCCTCAGG + Intronic
1082888285 11:58111276-58111298 CTGAATTTAAGGAGATGCTCAGG + Intronic
1086516106 11:87615224-87615246 CTTTATTTAATTAGCTGGCCTGG + Intergenic
1089176132 11:116550199-116550221 CAATATTTAAAGAGCTGCTGTGG + Intergenic
1089663599 11:120002175-120002197 CTGTCATCAAAGAGCTGGTTTGG - Intergenic
1091208550 11:133836819-133836841 CTGTATTCCCAGGGCTGGTCTGG + Intergenic
1092410685 12:8250735-8250757 ATGTATTTAGAGAGAGGGTCTGG - Intergenic
1095716815 12:45355414-45355436 CTGTATTTAAAGAGCTGGTCAGG - Intronic
1099077609 12:78130662-78130684 CAGTCATTAAAGAGCAGGTCAGG - Intronic
1099295012 12:80819647-80819669 CTGTGTTCACAGAGCTGGTGAGG - Intronic
1101069462 12:101058875-101058897 CAGTATTGAAAGTTCTGGTCAGG - Intronic
1107392859 13:39985250-39985272 CAGTTTTTAAAGAGCTAGGCTGG + Intergenic
1108327581 13:49348752-49348774 CTGTATTTCCAGAGATGGCCTGG + Intronic
1108427465 13:50318510-50318532 CTAAATTTAATGAGATGGTCTGG + Intronic
1109818239 13:67616645-67616667 ATGTGCTTAAAGAGCTGGACAGG + Intergenic
1110153355 13:72282605-72282627 CTGGATTTAAAGACGTTGTCAGG + Intergenic
1117602367 14:57389589-57389611 CCTGATTTATAGAGCTGGTCTGG - Intergenic
1119703148 14:76768647-76768669 CATTATTTAAAAAGCTGGGCTGG + Intronic
1121743161 14:96268013-96268035 CTGTATGTGAAGGGATGGTCTGG - Intronic
1122999041 14:105282218-105282240 CTGTATTTAGAGAAAGGGTCTGG - Intronic
1123065171 14:105615265-105615287 CTGGACTCAAAGAGCTGGTGTGG + Intergenic
1123069370 14:105634699-105634721 CTGGACTCAAAGAGCTGGTGTGG + Intergenic
1123094415 14:105759859-105759881 CTGGACTCAAAGAGCTGGTGTGG + Intergenic
1128327371 15:66733819-66733841 CTGGATTCAAAGACCTGGTGAGG + Intronic
1129506047 15:76082415-76082437 GTGTATTCCAAGAGTTGGTCAGG + Intronic
1132384975 15:101393842-101393864 CTGGGTTGAAAGAGCTGGTCTGG + Intronic
1133904798 16:10012427-10012449 CTTGAGTTAAAGGGCTGGTCTGG - Intronic
1136531936 16:30875614-30875636 CTGTATCTTAAGATCTGGTGAGG - Intronic
1138335824 16:56252111-56252133 CTGTATCAAATGAGCTGATCAGG + Intronic
1139966652 16:70749586-70749608 CTTTATTTAAAGTGCTGGAGGGG - Intronic
1139981206 16:70860441-70860463 CTGTGGTTAAGGAGGTGGTCAGG + Intronic
1140961695 16:79918887-79918909 CTGTACTGAAATTGCTGGTCTGG + Intergenic
1143694615 17:8603054-8603076 CTGTATCCATACAGCTGGTCTGG + Intronic
1145718588 17:27047125-27047147 TTTTTTTTAAAGAGCTGGCCAGG + Intergenic
1147018896 17:37514953-37514975 CTGTATTTTAAAAGATGGTGTGG - Exonic
1147267622 17:39244386-39244408 CTGTATATTAAGAGCTGACCAGG - Intergenic
1149216817 17:54365968-54365990 CTGTATGTAAAGAACTGTTCTGG + Intergenic
1149382454 17:56107526-56107548 CTGTGTTTAAGGAGCTTGTTGGG + Intergenic
1149437823 17:56648907-56648929 CTGCATTCAAAGGGCTGGGCTGG + Intergenic
1153339509 18:3960180-3960202 TTTTATTTAAAGAGCTGATCAGG - Intronic
1154957917 18:21277227-21277249 CTGTATTCAAAAGGCTGGGCTGG - Intronic
1156441372 18:37191788-37191810 CATTATTTAAATAGATGGTCAGG - Intronic
1162496425 19:11025578-11025600 CTGTTTTTAAAGAGCTGTCGAGG - Intronic
1166620803 19:44298298-44298320 GTGTATTTAAGGAGCTTGTAAGG - Intronic
926724942 2:15990277-15990299 CTGAATGGAAAGAGCTGGTGTGG + Intergenic
927584888 2:24293327-24293349 CTGATTTTAAAGAACTGTTCAGG - Intronic
929183431 2:39068136-39068158 TTGTATTTAAAAATGTGGTCTGG + Intronic
930114070 2:47703806-47703828 AGGTTTTTAAAGAGCAGGTCTGG - Intronic
930190426 2:48453486-48453508 GTATATTTAAAGAACTGGGCTGG - Intronic
930493643 2:52109755-52109777 CTGAAAGTAAAGAGCTGGCCGGG + Intergenic
931127074 2:59289853-59289875 CAGCATTAACAGAGCTGGTCAGG + Intergenic
934685542 2:96318618-96318640 CTGTATTTAAAAATCTGGGTTGG + Intergenic
937519433 2:122693613-122693635 ATGTTTTTGAAGAGCTAGTCGGG - Intergenic
942202635 2:173587141-173587163 CAGAATTTTAAGAGCTGGGCTGG - Intergenic
945281627 2:208040818-208040840 CTGTTTTGAAAGAGCTACTCTGG - Intergenic
945505817 2:210638833-210638855 CTGCTTTTAGAGAGCTGGTGGGG + Intronic
947581498 2:231322064-231322086 CCTTATTTAATGAACTGGTCTGG + Intronic
947703908 2:232259102-232259124 GTGTATTTAAAGAGAAGGTTGGG + Intronic
1168757488 20:326901-326923 CTGTATGTAAACAGCTGGTTTGG - Exonic
1170602612 20:17852723-17852745 CTGTATTTAAAAACCTGTTCAGG + Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1175320981 20:58088213-58088235 CTGCATGGAAGGAGCTGGTCTGG + Intergenic
1176161131 20:63649370-63649392 CAGTATTTTCAGAGCTGGTGAGG + Intronic
1177076361 21:16579633-16579655 ATTTATTTAAAGAGCTTTTCTGG + Intergenic
1178272271 21:31202088-31202110 CTGTATTTATATAGCTTCTCGGG - Intronic
1181762161 22:25066158-25066180 CTGTTTTTAAAGACAGGGTCTGG + Intronic
951676071 3:25243321-25243343 CAGTATTGAAAGTTCTGGTCAGG - Intronic
952848906 3:37711926-37711948 CTGTATTTGCAGGGCTGCTCAGG - Intronic
963074355 3:141332556-141332578 CTGTATTTCCAGAGCTTGTCAGG + Intronic
964820933 3:160768599-160768621 CTGTTTGTAAAGAGCTAGTCTGG + Intronic
965107458 3:164375656-164375678 CAGTATTTAAAAAGTTGCTCAGG + Intergenic
966085003 3:176060389-176060411 CTGTATTTCAGGAAATGGTCAGG + Intergenic
966181364 3:177191806-177191828 TTGTATTTAAAGAGTTTGCCTGG + Intronic
969228045 4:5811904-5811926 CTGTAGTGAGAGGGCTGGTCTGG - Exonic
969228140 4:5812307-5812329 CTGTAGTGAGAGGGCTGGTCTGG - Exonic
974711784 4:65606938-65606960 CTGTATTTAAAGAGGCAGTTAGG - Intronic
975479913 4:74866317-74866339 CTGGATTTTAAGAGCTTGGCAGG + Intergenic
976623754 4:87156250-87156272 CTGAATTTAAAAAGCAGGCCAGG + Intergenic
979528396 4:121741360-121741382 CTGTAGTCAAATAGGTGGTCAGG - Intergenic
982484387 4:155950365-155950387 CTGTGTCTAAAGAACTGGTCTGG - Intronic
982513753 4:156318202-156318224 CTGTATTTAAATAACTCTTCTGG - Intergenic
983953200 4:173666670-173666692 GTGTTTCTAAATAGCTGGTCAGG - Intergenic
984379635 4:178975138-178975160 ATATATTTAAAGATCTGTTCAGG - Intergenic
986301373 5:6481098-6481120 CTGTTTTTCAAGAGTTGGCCCGG + Intronic
988250207 5:28747550-28747572 GTATATTTAAATATCTGGTCAGG - Intergenic
992422284 5:76618424-76618446 TAGTACTTAAGGAGCTGGTCAGG + Exonic
996155611 5:120095145-120095167 CTGTATTTAAAATGCTGCCCAGG + Intergenic
999521577 5:152356393-152356415 CTGAATTTGAAGAGCTGCTTTGG + Intergenic
1001734431 5:173987460-173987482 ATGAATTTAAAGAGATGGTCGGG + Intronic
1004344603 6:14837050-14837072 CTGGATTTAAAGGGCAGGTAGGG + Intergenic
1006708023 6:36038731-36038753 TGTTATTTAAAGAGCTGGACTGG - Intronic
1011352577 6:86438738-86438760 CTGTTTTTAAAAAGCTGACCAGG - Intergenic
1011494962 6:87928492-87928514 CTGTATTTAAGGATCTGAACAGG - Intergenic
1012042590 6:94228319-94228341 CTGTATTTTAAGGGCAGGTTAGG - Intergenic
1012813541 6:103991355-103991377 ATATATTTTAAGAGCTTGTCTGG - Intergenic
1013989577 6:116237836-116237858 CTGCAGTTGAAGAGCTGGTGAGG - Intronic
1016871812 6:148825299-148825321 CTGTATTTAAATTGCTTGTTTGG + Intronic
1022577495 7:31512072-31512094 CTGTCTCTAATGATCTGGTCAGG + Intergenic
1023513531 7:40978143-40978165 CTGTATTCCAAGGGCTGGCCAGG - Intergenic
1024972801 7:55086201-55086223 CTCGAGTTAAAGAGCTGGCCAGG + Intronic
1028002459 7:85516579-85516601 CTCTATTTAAAGAACTTCTCAGG - Intergenic
1029017460 7:97329156-97329178 CTATAGTTACAGAGCTGGTGAGG - Intergenic
1030995006 7:116349537-116349559 CTACATTTAAAGTGCTGTTCTGG + Intronic
1031102993 7:117505500-117505522 CTTTATGTAGAAAGCTGGTCCGG - Intronic
1032056314 7:128687431-128687453 CTGAATTCACAGAGCTGTTCTGG - Intergenic
1033190319 7:139272379-139272401 TGGTATTTAAATAGCTGTTCAGG - Exonic
1034380149 7:150685127-150685149 CTGAAATTACAGAGCTGGACAGG + Intergenic
1034951497 7:155299498-155299520 GTTTATTTAACGAGCTTGTCGGG + Intronic
1039007282 8:33053744-33053766 CAGTATTGAAAGTTCTGGTCAGG + Intergenic
1039715785 8:40107279-40107301 CTGAATTTAATGGGGTGGTCAGG - Intergenic
1041197539 8:55416086-55416108 TTGTAATTAAAGACCTGGTCTGG + Intronic
1041840020 8:62258444-62258466 CTGTCTTTCCAGGGCTGGTCTGG - Intronic
1044445454 8:92270060-92270082 CTGTATTTAACAAGATTGTCAGG - Intergenic
1044767756 8:95594817-95594839 CTGTATTTAAACATCTGGTTGGG - Intergenic
1047128121 8:121985856-121985878 CTGCTCTTAAAGAGCTGGACTGG - Intergenic
1048695070 8:137018431-137018453 CTTTCTTCAGAGAGCTGGTCTGG + Intergenic
1048876873 8:138843481-138843503 ATGTATTTAAAGTGCTGAGCAGG + Intronic
1050364200 9:4859065-4859087 GTGTATTTAATGAACTGTTCAGG + Intronic
1051657500 9:19397020-19397042 CTGTATAGAAAGAGGTGGTAAGG - Intergenic
1055612446 9:78037070-78037092 CTCTATTTAAAATGCTGGGCTGG + Intergenic
1056169176 9:83966218-83966240 TTGTTTTTAAAAAGATGGTCTGG - Intergenic
1058729315 9:107834923-107834945 GCGTAGTTAAAGAGATGGTCAGG + Intergenic
1061414132 9:130436853-130436875 CTGTCTTAACAGAGCTGTTCTGG + Intergenic
1186052900 X:5618592-5618614 CTGTAATTCAAGAGTTGGCCAGG + Intergenic
1186644617 X:11493408-11493430 ACGCATTTAAAGTGCTGGTCAGG - Intronic
1190851992 X:54253674-54253696 TTGTTTTTAAAAAGCTTGTCAGG + Intronic
1190976428 X:55406543-55406565 CATTATTTAAAGTGCTGGTTTGG - Intergenic
1195674236 X:107495283-107495305 CAATATTTAAAAAGGTGGTCAGG - Intergenic
1199792674 X:151169730-151169752 CTGTTTTCAGGGAGCTGGTCAGG + Intergenic