ID: 1095718776

View in Genome Browser
Species Human (GRCh38)
Location 12:45377389-45377411
Sequence ATAACGTATCTGGCCAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095718776 Original CRISPR ATAACGTATCTGGCCAAATA AGG (reversed) Intronic
902788354 1:18747463-18747485 TTAACGCATCTGGCCAACTTGGG + Intronic
906301535 1:44685599-44685621 ATAAGCTATCTGGCCAGGTATGG - Intronic
908661288 1:66438228-66438250 ATAACGGATGTGGCCAGAAATGG + Intergenic
915747096 1:158170878-158170900 ATAACATATCTATGCAAATAGGG - Intergenic
917245304 1:172994782-172994804 CTAAAGTTTTTGGCCAAATAAGG - Intergenic
918528766 1:185494395-185494417 ATAACGTAAATAGCTAAATATGG + Intergenic
918619042 1:186581432-186581454 ATAACAAATTTGGCCAAACATGG - Intergenic
921239400 1:213162571-213162593 ATAACATTGCTGGCCAAGTATGG - Intronic
1067268110 10:44764994-44765016 AGAATGTATCTGGCCATATGGGG - Intergenic
1071056893 10:81521532-81521554 AAAACATATCTGGACAAATGGGG + Intergenic
1072814262 10:98489226-98489248 AAAATCCATCTGGCCAAATATGG - Intronic
1082175612 11:49055600-49055622 ATAACATATCTGGAGAAATTGGG - Intronic
1086698525 11:89872503-89872525 ATAACGTATCTGGGGAAATTGGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1094759868 12:33520117-33520139 ATAAAATATCTGAACAAATAGGG - Intergenic
1095718776 12:45377389-45377411 ATAACGTATCTGGCCAAATAAGG - Intronic
1100459479 12:94784998-94785020 ATAAAGTAGCTGGGCAAAAAAGG + Intergenic
1107923603 13:45235893-45235915 ATAAAGTATCTGGCCATGTGCGG - Intronic
1111090019 13:83433248-83433270 ATATGGTTTCTGGCCAAAGATGG + Intergenic
1120366775 14:83581349-83581371 ATAAACTATCTGGACAAAAATGG - Intergenic
1121684877 14:95828386-95828408 ATAAATTATAAGGCCAAATATGG - Intergenic
1132052198 15:98616441-98616463 ATAACGTATCTTGCAATTTAGGG - Intergenic
1146660419 17:34661890-34661912 ATACCGTATCTGACCATATATGG + Intergenic
1150474748 17:65466459-65466481 ATAAAGTGTCTGGCAAAAGAAGG + Intergenic
1155807101 18:30185094-30185116 ATAAAATATCTGGCCAGAGATGG + Intergenic
1156780094 18:40840364-40840386 ATAAAGTATCTGGCCAGGCACGG + Intergenic
1159734854 18:72082988-72083010 ATCACATATTTTGCCAAATAGGG - Intergenic
1163882508 19:19938604-19938626 CTAACGTTTTTGGCCTAATAAGG + Intergenic
1165930240 19:39353061-39353083 ATAACGCATCTGTCCAAGAATGG - Intronic
925002812 2:419870-419892 ACAATGTATCTGGGCACATATGG - Intergenic
925667881 2:6281015-6281037 ATCACTTACCTGGCCAATTAAGG + Intergenic
928953417 2:36835731-36835753 ACAACATATATGACCAAATAGGG + Intergenic
932626240 2:73298373-73298395 ATAAAGGATCTGGCTATATATGG + Intergenic
940125008 2:150312579-150312601 ATTTCGTATCTGGCCAAACTAGG + Intergenic
942138598 2:172954919-172954941 ATAAGGTACCTGGCCAAAATGGG - Intronic
942406914 2:175665898-175665920 ATAACACCTCTGGTCAAATATGG + Intergenic
945023410 2:205596720-205596742 ATCATGTTTGTGGCCAAATAGGG + Intronic
1172928339 20:38561730-38561752 AGAACTTATCTGGCCCAAGATGG - Intronic
1177024768 21:15908250-15908272 ATCACTAATCTTGCCAAATAAGG + Intergenic
1183570437 22:38649272-38649294 AAAATGTATCTGGCCAGATGCGG + Intronic
951910607 3:27746719-27746741 ACAACCTCTCAGGCCAAATAGGG - Intergenic
956861886 3:73332760-73332782 ACAACGTATCTGGCTAAATGTGG + Intergenic
958130463 3:89413541-89413563 AAAACCTATTTGGCTAAATAAGG + Intronic
963413734 3:144966593-144966615 ATAATATATATGGCCAAAGATGG + Intergenic
972058588 4:34837142-34837164 ATAAAGTATCTGGGAAGATATGG + Intergenic
984356808 4:178670462-178670484 ATAATGTATATGAGCAAATAGGG + Intergenic
985959527 5:3290101-3290123 ATAACCTTTATGTCCAAATAAGG + Intergenic
985976754 5:3425322-3425344 ATAACATATCTGGTCAACGAGGG + Intergenic
990376678 5:55177291-55177313 ATAGGGTAACTGCCCAAATAAGG + Intergenic
992478397 5:77126330-77126352 ATGACGTATATTGGCAAATAAGG - Intergenic
992864981 5:80949157-80949179 ATAACATATTTGTACAAATATGG + Intergenic
994811573 5:104525615-104525637 ATTAATTATCTGGCCAAAAAAGG - Intergenic
996047887 5:118896649-118896671 ATAAAATATGTGGCCGAATAGGG + Intronic
1003754693 6:9103938-9103960 TTAAAGTATCTGGCCCAATTTGG + Intergenic
1019082433 6:169444160-169444182 ATAAAGGATATGGGCAAATAGGG - Intergenic
1021424108 7:20479834-20479856 AGAATGTATCTGGTAAAATAAGG + Intergenic
1022266909 7:28765804-28765826 ATAAAGTATGTTTCCAAATATGG + Intronic
1028354648 7:89891415-89891437 ATCACATATTTGGCAAAATAGGG + Intergenic
1028676184 7:93464580-93464602 ATAAAGTCTCTTGTCAAATAGGG - Intronic
1031138468 7:117913156-117913178 ATAAAGTATCTAGAAAAATATGG + Intergenic
1043445891 8:80318857-80318879 ATAATTTATCTGGCCAGGTACGG - Intergenic
1046290890 8:112159405-112159427 ATAATGTGTCTGGTCAGATATGG - Intergenic
1046963075 8:120130336-120130358 ATGACCTATCTGGCCAAATGTGG - Intronic
1048469334 8:134693330-134693352 TTAACACAACTGGCCAAATATGG + Intronic
1055084024 9:72295800-72295822 ATAACATATTTGGCCATATATGG - Intergenic
1060374116 9:123103264-123103286 ATCACACATCTGGCCAAAGAAGG - Exonic
1060787737 9:126463925-126463947 ATCACTTATCTGCCCAAGTACGG - Intronic
1060961100 9:127681332-127681354 AAAACGTTTTTTGCCAAATATGG + Intronic
1186876061 X:13819377-13819399 AGAACTTTTCTGGCCAAAAATGG - Intronic
1188686147 X:33072972-33072994 CTAAATTTTCTGGCCAAATAGGG - Intronic
1198248079 X:134850951-134850973 TTATTGTATCTGGCCAAAAATGG - Intronic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic