ID: 1095719005

View in Genome Browser
Species Human (GRCh38)
Location 12:45380216-45380238
Sequence GAGTCCTAAACACCAACCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095719002_1095719005 1 Left 1095719002 12:45380192-45380214 CCCACCTGTTCATACTGATTCAT 0: 1
1: 0
2: 0
3: 18
4: 233
Right 1095719005 12:45380216-45380238 GAGTCCTAAACACCAACCCATGG 0: 1
1: 0
2: 0
3: 14
4: 101
1095719001_1095719005 19 Left 1095719001 12:45380174-45380196 CCTTTCAGGACAAGGCAGCCCAC 0: 1
1: 0
2: 0
3: 11
4: 160
Right 1095719005 12:45380216-45380238 GAGTCCTAAACACCAACCCATGG 0: 1
1: 0
2: 0
3: 14
4: 101
1095719000_1095719005 23 Left 1095719000 12:45380170-45380192 CCATCCTTTCAGGACAAGGCAGC 0: 1
1: 0
2: 0
3: 18
4: 166
Right 1095719005 12:45380216-45380238 GAGTCCTAAACACCAACCCATGG 0: 1
1: 0
2: 0
3: 14
4: 101
1095719003_1095719005 0 Left 1095719003 12:45380193-45380215 CCACCTGTTCATACTGATTCATA 0: 1
1: 0
2: 0
3: 8
4: 149
Right 1095719005 12:45380216-45380238 GAGTCCTAAACACCAACCCATGG 0: 1
1: 0
2: 0
3: 14
4: 101
1095719004_1095719005 -3 Left 1095719004 12:45380196-45380218 CCTGTTCATACTGATTCATAGAG 0: 1
1: 0
2: 0
3: 5
4: 120
Right 1095719005 12:45380216-45380238 GAGTCCTAAACACCAACCCATGG 0: 1
1: 0
2: 0
3: 14
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095719005 Original CRISPR GAGTCCTAAACACCAACCCA TGG Intronic
900334702 1:2156579-2156601 GAGTCCTCAAGACCATCCCCAGG + Intronic
903314797 1:22494531-22494553 GGTTCCAAAACAGCAACCCATGG - Intronic
905392154 1:37643598-37643620 GAGTCCTAAACCCCATTCCAGGG + Intergenic
908009969 1:59765846-59765868 GAATCCTTACCACCAACCCTAGG - Intronic
913064328 1:115236285-115236307 GAGTCCTGGACACCCAGCCAAGG + Intergenic
916334840 1:163659223-163659245 GAGTCCCAAGCACCAAGCCCAGG + Intergenic
916411038 1:164547229-164547251 GAGTCCTAGACACAAACACAAGG - Intergenic
916598789 1:166272420-166272442 CACACCTAAATACCAACCCATGG - Intergenic
917493459 1:175518428-175518450 CAGTCCTAAATACCATCACAAGG + Intronic
918148817 1:181780945-181780967 GGGTCAGAAACTCCAACCCATGG + Intronic
918240794 1:182618363-182618385 CAGTCCTAAACAGGAATCCAGGG - Intergenic
920822109 1:209390857-209390879 GAGTTCTGAACCCCAAGCCACGG + Intergenic
1063845480 10:10122861-10122883 GAGGCCTCAGCACAAACCCAGGG - Intergenic
1071263767 10:83945461-83945483 GAGTCATGAAGACCATCCCAGGG - Intergenic
1072886092 10:99275644-99275666 TAATCCTAAACTCCATCCCAAGG + Intergenic
1073852248 10:107634584-107634606 GAGTCACAGACACTAACCCATGG + Intergenic
1074234043 10:111566864-111566886 GAGGCTTAAACACATACCCATGG + Intergenic
1074999717 10:118786653-118786675 GAGTCCTAAAGCCCAGTCCATGG - Intergenic
1075234349 10:120712919-120712941 GATTCCTAGACTCTAACCCATGG - Intergenic
1079506242 11:21155617-21155639 CACTCCTAAATACCAAACCAAGG - Intronic
1081637420 11:44729715-44729737 GTGTCCTAAACCCAACCCCAAGG - Intronic
1083323490 11:61861852-61861874 GAGGCCTAAACCAGAACCCACGG - Intronic
1088001814 11:104891197-104891219 GAGTCTGAAAGACAAACCCAAGG - Intergenic
1088941224 11:114458676-114458698 GAGTCCCAAACTCCAACAGAGGG - Intergenic
1089046803 11:115508205-115508227 CACTCCTAAACACCATCACATGG - Intergenic
1089707595 11:120291347-120291369 TAGTCCTAAAGACCAAGCCAGGG - Intronic
1090901568 11:131037046-131037068 GAGGCCTAAACACCAAGGTACGG + Intergenic
1095710167 12:45279626-45279648 GTGTCCTAAACACTGACCCAGGG - Intronic
1095719005 12:45380216-45380238 GAGTCCTAAACACCAACCCATGG + Intronic
1103218504 12:119223235-119223257 GATCCCTAAACACAAACCCAAGG + Intergenic
1103903316 12:124314714-124314736 GAGTCCTTGACACCAAAACAAGG - Exonic
1104874502 12:132024630-132024652 GAGCCCTAAACAAAAACACAGGG - Intronic
1109181713 13:59221735-59221757 TAGTCCTAAACACAAACCACAGG - Intergenic
1114193711 14:20459669-20459691 GAGTCCAGAACCCCAACCCATGG - Exonic
1118544469 14:66871467-66871489 GAGCCCTAAACATCAAGCAAGGG - Intronic
1120222530 14:81750485-81750507 GAGTCCTCAAAACAAAGCCATGG - Intergenic
1121300665 14:92868059-92868081 GTGTCCTAATCACCTCCCCAGGG + Intergenic
1122315107 14:100821292-100821314 GACTTCTAAAATCCAACCCATGG + Intergenic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1126911318 15:53419833-53419855 GAGTCATAAAGACAAGCCCAGGG + Intergenic
1127842223 15:62841377-62841399 GAGTCATCCACACAAACCCACGG + Exonic
1127886759 15:63208207-63208229 GAATCCTAAACTCTAACCCAGGG + Intronic
1128620285 15:69143317-69143339 GTCTCCTAGAAACCAACCCAAGG + Intergenic
1134601499 16:15537254-15537276 GACTTCTAAAAACCAACACAGGG + Intronic
1135752907 16:25071031-25071053 GGGCCCTGAACACAAACCCAGGG - Intergenic
1141646508 16:85370689-85370711 GAGTTCTAGGCCCCAACCCAGGG + Intergenic
1146257913 17:31402269-31402291 AAGTCCTAAGCACAGACCCAGGG + Intronic
1147299371 17:39512297-39512319 GATTCCTAACCACCCACCCAGGG + Intronic
1147958423 17:44150997-44151019 GCGCCCCAAACTCCAACCCATGG + Exonic
1148750136 17:49940859-49940881 GAGACCCAAACTCCAGCCCAGGG - Intergenic
1148882722 17:50743056-50743078 GAATCCTAAACACAATCCCCAGG - Intronic
1150280395 17:63926812-63926834 GAATCCTAAACCCCATCCGAGGG - Intergenic
1150777929 17:68096713-68096735 GAGACATAAACATAAACCCAAGG + Intergenic
1157807067 18:50665960-50665982 GACTCCAAACCACCAAACCAAGG + Intronic
1158170276 18:54590798-54590820 GACTTCCAGACACCAACCCAGGG + Intronic
1158177619 18:54675183-54675205 GAGTCCTTAACATCAGCCTAAGG + Intergenic
1160729222 19:633182-633204 GAGCCCTAAACACCACACCTGGG + Intronic
1162998456 19:14351066-14351088 GGGTCCTTAAGACCAACCCATGG - Intergenic
1165926550 19:39329729-39329751 GAGTCCCAGACATCAACCCTGGG - Intronic
925351005 2:3200725-3200747 GAGTCATGAACACCAGGCCAAGG + Intronic
926977083 2:18525931-18525953 GAGTCCCTGACACCACCCCAAGG - Intergenic
934609678 2:95725565-95725587 GAGTCCAAAGTACCATCCCAGGG - Intergenic
936184447 2:110292143-110292165 TAGTCCTCACCCCCAACCCACGG + Intergenic
939044672 2:137236330-137236352 GAAACCAAAACACCAACCCAGGG - Intronic
939208529 2:139140616-139140638 AAGCCTTAAACTCCAACCCATGG + Intergenic
941570739 2:167166788-167166810 GAGGCCTCAACACCAACACTGGG + Intronic
942663829 2:178295246-178295268 GATTACTAAACAGCATCCCATGG - Intronic
946087932 2:217193404-217193426 GAGTCCTAAACGTAAATCCATGG + Intergenic
947863713 2:233381028-233381050 GACTCCAAAACACCAACTCATGG - Intronic
948165949 2:235862801-235862823 GAGGCATAAAGAACAACCCAGGG - Intronic
948681564 2:239638654-239638676 AAATCCTAAGCACCCACCCATGG + Intergenic
1178984405 21:37290641-37290663 GAGCTCTGAACACCACCCCAGGG + Intergenic
952382127 3:32813635-32813657 GTGGCCTAACCCCCAACCCAAGG + Intergenic
956326238 3:68055962-68055984 GTGAGCTGAACACCAACCCAGGG - Intronic
956702207 3:71968261-71968283 CAGCCCTAATCACCAAGCCAAGG + Intergenic
964247140 3:154666770-154666792 GAGTCACAAACACCCACCCCTGG - Intergenic
974145270 4:57938396-57938418 GAGTAGTAAACAACAAGCCAGGG + Intergenic
974339700 4:60599674-60599696 CATTCCTACACACCAACCAAAGG - Intergenic
975525083 4:75340094-75340116 CAGTCTTAAATCCCAACCCACGG - Intergenic
985534173 5:454030-454052 GGGTCTTAAACACCTACACAAGG + Exonic
985542563 5:493699-493721 GATTCCAAAACACCAGCCCCGGG + Intronic
985859337 5:2458126-2458148 GAATCCCCAACTCCAACCCAAGG - Intergenic
990341203 5:54824923-54824945 GAGTCCTAAACACAAATTCCAGG + Intergenic
1000423263 5:161061383-161061405 GAGCCCTAATCAATAACCCATGG - Intergenic
1002431552 5:179206982-179207004 GAGGGCCAGACACCAACCCAGGG - Intronic
1003077188 6:2992723-2992745 GAGACCAAGACAGCAACCCATGG - Intronic
1008821129 6:55631541-55631563 GAGTCGTAGACACCAAAGCAGGG - Intergenic
1012753886 6:103199078-103199100 GTAACCTAAACACCAACTCATGG - Intergenic
1013603649 6:111728074-111728096 GAGGCTTTAACACCAAACCATGG + Intronic
1015413992 6:132927884-132927906 CTGTCTTAATCACCAACCCAGGG - Intergenic
1019728084 7:2613912-2613934 CAGGGCTAAACTCCAACCCAGGG + Exonic
1020366588 7:7387052-7387074 GTGACCTAATCACCACCCCAAGG + Intronic
1021556170 7:21920745-21920767 GAGTGCTAAACAACAACAAAAGG - Intronic
1022814355 7:33900260-33900282 GAGATCTCAAGACCAACCCAGGG - Intergenic
1024230781 7:47361620-47361642 GTGTGCTAAACCCCAACCAAAGG - Intronic
1025035495 7:55590617-55590639 GAGTCAGAAACACCAAGGCAGGG - Intergenic
1030745886 7:113166002-113166024 GAGACCTAAAGAGTAACCCAGGG + Intergenic
1032766841 7:135002139-135002161 GAGTCCTGAAGACCACCCCAAGG + Intronic
1037343327 8:17870978-17871000 GAGTCCTATAAACAAACTCAAGG + Intronic
1038078842 8:24109113-24109135 GATTTCTAAACAACAGCCCATGG - Intergenic
1039513149 8:38107472-38107494 AAATCCAAAACACCAACACAAGG - Intronic
1040296537 8:46151892-46151914 CAGCCCCAAACTCCAACCCAGGG - Intergenic
1041111675 8:54488647-54488669 GAGTTAGAAACACCAACACAGGG - Intergenic
1042393657 8:68265531-68265553 GAGTCTCAAACACAAAGCCATGG - Intergenic
1047976220 8:130133353-130133375 GAGTGCAAAACTCCAACCCAGGG + Intronic
1048082901 8:131148458-131148480 TAATTCTGAACACCAACCCAAGG - Intergenic
1049801305 8:144518567-144518589 AAGTCCCAGACACCAACCCTCGG - Intronic
1052320423 9:27161667-27161689 AAGTCCTAAAAAGCAACCCAGGG + Intronic
1052810294 9:33052506-33052528 GAGTACTACACACCAGCCCCTGG + Intronic
1061075913 9:128341131-128341153 GAGTCCTCAACCCCAACGCCAGG - Intronic
1061315389 9:129792465-129792487 GAGTCCTAGACAACACCCCGGGG + Intergenic
1186592202 X:10942579-10942601 GAGTTTTAAACAACAACCTAAGG - Intergenic
1187585106 X:20651680-20651702 GAGTCCTTGACACCATCACAGGG - Intergenic
1189221681 X:39377610-39377632 GATTCCTAAAAAAGAACCCAGGG - Intergenic
1189642143 X:43084674-43084696 GAGTCCTCAACCCCTAGCCATGG - Intergenic
1202600239 Y:26586869-26586891 GAGTGCTAAAAACCAAGTCATGG + Intergenic