ID: 1095721519

View in Genome Browser
Species Human (GRCh38)
Location 12:45406322-45406344
Sequence CAAAACACTAAGGTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095721519_1095721528 23 Left 1095721519 12:45406322-45406344 CCCAGCTCCACCTTAGTGTTTTG 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1095721528 12:45406368-45406390 TTTATTCTGTTCTTAATAAAAGG 0: 1
1: 0
2: 4
3: 61
4: 745
1095721519_1095721526 -2 Left 1095721519 12:45406322-45406344 CCCAGCTCCACCTTAGTGTTTTG 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1095721526 12:45406343-45406365 TGATATTTAAGGTATTCCTGGGG 0: 1
1: 0
2: 3
3: 21
4: 213
1095721519_1095721524 -4 Left 1095721519 12:45406322-45406344 CCCAGCTCCACCTTAGTGTTTTG 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1095721524 12:45406341-45406363 TTTGATATTTAAGGTATTCCTGG 0: 1
1: 0
2: 1
3: 23
4: 250
1095721519_1095721525 -3 Left 1095721519 12:45406322-45406344 CCCAGCTCCACCTTAGTGTTTTG 0: 1
1: 0
2: 0
3: 17
4: 139
Right 1095721525 12:45406342-45406364 TTGATATTTAAGGTATTCCTGGG 0: 1
1: 2
2: 3
3: 18
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095721519 Original CRISPR CAAAACACTAAGGTGGAGCT GGG (reversed) Intronic
901326767 1:8371342-8371364 CTATACACTAAGATGGAGTTAGG + Intronic
909609253 1:77535707-77535729 CATTACACTATGGTGCAGCTGGG - Intronic
909803363 1:79843542-79843564 CCAAACACTGAGGTTGAGTTTGG + Intergenic
910862784 1:91759104-91759126 CAAATGACTAAGGTGAAACTTGG + Intronic
912722632 1:112032922-112032944 CAAAGCTCTCAGGTGGAGTTAGG - Intergenic
912986999 1:114443736-114443758 AAAAATATTAAGGTGGAGCCAGG + Intronic
916260459 1:162836777-162836799 ATAAACACTGAGCTGGAGCTAGG + Intronic
916441079 1:164825250-164825272 AAAGACACGAAGGAGGAGCTGGG - Intronic
916790617 1:168121897-168121919 CAAATCCCTAAGGTGAAGCTGGG + Intronic
916790845 1:168123793-168123815 AAAATCCCTAAGGTGAAGCTGGG + Intronic
919845140 1:201637586-201637608 CACAACACTAAGAGGGACCTTGG - Intronic
924602919 1:245507265-245507287 GCCAACACTCAGGTGGAGCTGGG + Intronic
1063147969 10:3313768-3313790 CAAAGCTTTAAGGAGGAGCTGGG + Intergenic
1063786377 10:9389548-9389570 CAAAAAACTGAGTTGGAGCAGGG + Intergenic
1064469226 10:15618347-15618369 CAAAAAACAAAGGTGGAGGGAGG + Intronic
1071135097 10:82444551-82444573 GAAAATACTAAGGTGGAGGGGGG + Intronic
1073828072 10:107348844-107348866 CCATACACTAAGATGGAGCAGGG - Intergenic
1074162626 10:110846748-110846770 CCAAACACTAGGGTGCAGCTGGG + Intergenic
1075273177 10:121070706-121070728 CAAGACCCTGAGGTGGTGCTTGG - Intergenic
1075292176 10:121240207-121240229 GAAGACACTGGGGTGGAGCTGGG - Intergenic
1076987271 11:247534-247556 GAAATTACTAAGGTGGGGCTGGG + Intronic
1077715915 11:4580472-4580494 CAAAATACTAAGGTGTTGGTAGG + Intergenic
1082803911 11:57434686-57434708 GAAAATATCAAGGTGGAGCTTGG + Intergenic
1082908872 11:58346838-58346860 TAAAACACTGAGGTGAAGCTAGG - Intergenic
1082910572 11:58369229-58369251 TAAAAAACTGAGGTGAAGCTGGG - Intergenic
1083094484 11:60235562-60235584 CAAAAAAGTAAGGTGGTGCAAGG - Intronic
1083367551 11:62150604-62150626 CAGAACACCAAGCTGGAGCCTGG + Intronic
1083488665 11:62999103-62999125 CAGAACACTAATCTGGTGCTTGG - Intronic
1085432064 11:76461634-76461656 TAAAACACTAGGCTGGAGCCGGG + Intronic
1086827305 11:91515450-91515472 AAAAACACCAATGTGGAGATGGG - Intergenic
1091521243 12:1245814-1245836 CAAAACACAAAGGTAGAAATAGG - Intronic
1093943684 12:25083710-25083732 CAATAAATTAAGGTGGAGCTAGG - Intronic
1095244052 12:39898317-39898339 CAAAACATTAGGGTGAAGCATGG + Intronic
1095683517 12:45005728-45005750 CAAAACAGCAAGGTTGGGCTGGG - Intergenic
1095721519 12:45406322-45406344 CAAAACACTAAGGTGGAGCTGGG - Intronic
1098392383 12:69983098-69983120 CAAAAAACTCAGGAGGAACTGGG + Intergenic
1100426439 12:94491425-94491447 CAAAACACTGAGTTTGAGATGGG + Intergenic
1102695930 12:114799556-114799578 GAAAAAACTAAAGTGGAACTGGG + Intergenic
1104503020 12:129303950-129303972 CAGAACACAAAGGTGGAGGCAGG - Intronic
1107711788 13:43157810-43157832 CAGAACACTGAGATGGAGTTAGG + Intergenic
1107773837 13:43816726-43816748 CAAAACATTACGTTCGAGCTTGG + Intergenic
1109972960 13:69794279-69794301 CAAAACAATCAGGAGTAGCTGGG - Intronic
1112772017 13:102801943-102801965 CCAAAAAGTAATGTGGAGCTTGG + Intronic
1114352414 14:21867653-21867675 AAAAACATTATGGTGGAGTTTGG + Intergenic
1114642805 14:24235598-24235620 CAAAGAACTCAGGTTGAGCTGGG - Intronic
1115577156 14:34722917-34722939 AAAAAGACTAAGAAGGAGCTTGG + Intergenic
1117267233 14:54102614-54102636 CTAAACACTTAGGTGGTCCTTGG + Intergenic
1117384558 14:55198052-55198074 CAAGACACCAAGATGTAGCTAGG - Intergenic
1119084340 14:71726120-71726142 CAAAACTCTAAAGTGGTCCTTGG - Intronic
1119387736 14:74268357-74268379 GAAAACATTAAGGCTGAGCTGGG + Intergenic
1119559349 14:75578232-75578254 CAGAACACTTAGGTGGCGCCGGG + Intergenic
1120435969 14:84483078-84483100 CAAAATAATAAGGTTCAGCTTGG - Intergenic
1120623722 14:86798160-86798182 GAAAACATTAAGGTAGAGATTGG - Intergenic
1120727404 14:87960242-87960264 CCAGACACTAGGGTGGGGCTGGG + Intronic
1125039703 15:35170979-35171001 TAAAACACAATGGTGGAGCTTGG + Intergenic
1128603080 15:69014455-69014477 AAAAATACTATGGTGAAGCTAGG - Intronic
1131029971 15:89178409-89178431 CATCACACCAAGGTGGAGCCGGG + Intronic
1135418451 16:22287542-22287564 CAAGCCACTAAGCTGGAGCTGGG + Exonic
1139767567 16:69244267-69244289 AAAAAAACTAAGGTGCAGCACGG + Intronic
1141961130 16:87410083-87410105 CAAAACCCTAGATTGGAGCTTGG - Exonic
1143918811 17:10314632-10314654 CAGAAGAAAAAGGTGGAGCTTGG + Intronic
1144070438 17:11666701-11666723 CAAAATGGTAAGGTGGACCTAGG - Intronic
1144697847 17:17317470-17317492 CAAAACCACAAGGAGGAGCTGGG + Intronic
1148934597 17:51154892-51154914 CCAAACACTGCGGTGGAACTAGG - Intronic
1157078900 18:44499698-44499720 CACAACAATAAAATGGAGCTTGG - Intergenic
1162724097 19:12679612-12679634 CAGAACACAGAGGTGGGGCTGGG - Exonic
1168685216 19:58345366-58345388 TAAAAAACTAAGCTGGGGCTGGG + Intronic
927292517 2:21419220-21419242 CAAAACAAGAGGGTGAAGCTGGG + Intergenic
929250754 2:39752329-39752351 GAAAAAACGATGGTGGAGCTAGG + Intronic
930204400 2:48573550-48573572 CACAACACTGATGTGGGGCTTGG - Intronic
930625260 2:53689935-53689957 CTAAAAACTAAGCTGAAGCTAGG + Intronic
930865541 2:56119189-56119211 CAAAACTCTATGGTGAGGCTTGG + Intergenic
930881992 2:56280701-56280723 AAAAACAATGAGGTGGAGGTGGG + Intronic
932269777 2:70399322-70399344 CACCACGCTAAGGTGGAGCTGGG - Intergenic
936012125 2:108931470-108931492 AAGAACACTAAGCTGGGGCTGGG - Intronic
938137247 2:128769650-128769672 GGAGACACTGAGGTGGAGCTGGG + Intergenic
938730736 2:134145071-134145093 CAAAAGACCAAGGTGGGGGTTGG - Intronic
942267110 2:174239581-174239603 CAAAACACTTAAATGCAGCTGGG + Intronic
947792970 2:232878249-232878271 CAGCACACTGAGGTGGAGCTGGG + Intronic
947979492 2:234396951-234396973 CAGCACACTAGGTTGGAGCTGGG + Intergenic
1169050530 20:2573207-2573229 CAATACACTATGGTGGAACTTGG - Intronic
1173554801 20:43958504-43958526 TAAAGCACTAAGGTGGAGATAGG - Intronic
952251992 3:31664405-31664427 AACAACACAGAGGTGGAGCTGGG - Intronic
953144445 3:40261542-40261564 CGAAACATTGAGGTGGAGCCCGG - Intergenic
954893574 3:53955481-53955503 CAAAAGAATAAGGTAGAGTTAGG + Intergenic
956757919 3:72407738-72407760 CAAAGAACTAAGGTGAATCTGGG + Intronic
956782691 3:72616824-72616846 GAGAAAACTAAGGTGGAGCGAGG - Intergenic
956813469 3:72887502-72887524 CAAAACACCAAAGTAGAACTTGG - Intergenic
957197836 3:77093346-77093368 CAAAACAGTAAGGGGGAGTGGGG - Intronic
957199071 3:77108744-77108766 CAAAACCCTGAGGTTGTGCTTGG + Intronic
957964647 3:87306810-87306832 CAAAACACTAAGACAGAGATAGG + Intergenic
959479374 3:106853190-106853212 CAAAACACAAAAAAGGAGCTCGG + Intergenic
960046951 3:113208391-113208413 CAAAACAGTTAGGTGGAGTCTGG - Intergenic
961236234 3:125370669-125370691 CAAATCACTATGGTGGATGTTGG - Intronic
962375928 3:134858725-134858747 GAGGACACTAAGGTGGAGCAGGG + Intronic
964373274 3:156023976-156023998 GAAAACACTGAGGTAGAGATGGG - Intergenic
966515262 3:180813353-180813375 CAAAACATTATGGAGGAGATGGG + Intronic
967735109 3:192943476-192943498 TCAAACACTAGGGTGGAGTTAGG - Intergenic
968827583 4:2910892-2910914 GAAAACACAAAGGTGGAACAAGG - Intronic
970520797 4:16881870-16881892 CAAAACAGGGAGGTGAAGCTAGG - Intronic
976152593 4:82107154-82107176 CAAAACAGGATGGTGGAGCTGGG + Intergenic
977723960 4:100272354-100272376 CAAAAAAAAAAGGTAGAGCTGGG + Intergenic
979024745 4:115554962-115554984 GAAAGCACAAAGGTGGAGTTAGG - Intergenic
980434790 4:132756673-132756695 CAGAACACTAATCTGGAGGTGGG - Intergenic
981383710 4:144102589-144102611 CAAAACACATTGGTAGAGCTGGG - Intergenic
982052779 4:151518966-151518988 CAAAAAATTAAGATGCAGCTAGG - Intronic
982106461 4:152015737-152015759 AAAAACACAAAGGAGCAGCTGGG - Intergenic
982951487 4:161702701-161702723 CAGAACACTAAAGTGCATCTGGG - Intronic
988414210 5:30925536-30925558 CAAAATAGTGAGGTGGAGCCAGG + Intergenic
988717537 5:33842879-33842901 AGAAACACTAAGGTAGAGCTGGG + Intronic
992737653 5:79739685-79739707 CAAAACAATAAGAGGGGGCTGGG + Intronic
995897092 5:117027248-117027270 CAAAACACTAATTTGGAGTTTGG + Intergenic
997150168 5:131485085-131485107 CAAAACACTAAAATTTAGCTGGG - Intronic
998782683 5:145675923-145675945 AAAAACAATAATGTGGGGCTGGG + Intronic
999217622 5:149948515-149948537 GAAAACATTAGGGTGAAGCTTGG - Intergenic
1000005906 5:157184794-157184816 CAGAAGACCAAGGTGGTGCTTGG - Intronic
1000202310 5:159023557-159023579 CAATACACTATGGTGGAGGAAGG - Intronic
1000536558 5:162485530-162485552 CAGAAGACTAAGGTGGAGAGAGG + Intergenic
1000876541 5:166645828-166645850 TAAAACATTAAGGGGGAGCCGGG - Intergenic
1001954735 5:175841379-175841401 CAAAGCACAAAGGTGCACCTGGG + Intronic
1002022433 5:176372381-176372403 CAAGTCACTTAGGTGGAGCTGGG - Exonic
1006269193 6:32950859-32950881 AAAAACAGCAAGGTGGGGCTAGG + Intronic
1006370895 6:33643055-33643077 GAAAAGACAAAGATGGAGCTTGG + Intronic
1007183476 6:39947826-39947848 CTAAACACTGAGCTGAAGCTTGG - Intergenic
1007832139 6:44646784-44646806 CCAAACCCAAAGGTTGAGCTGGG + Intergenic
1008378555 6:50818986-50819008 CAAAGCTCTAAGGTGCATCTGGG - Intronic
1011080845 6:83489096-83489118 CAAAATACAATGGTGGGGCTGGG + Intergenic
1014458961 6:121672329-121672351 CAAAACTATAAAATGGAGCTGGG + Intergenic
1015011685 6:128356996-128357018 CAGAACTCCATGGTGGAGCTGGG + Intronic
1019836437 7:3389764-3389786 CAAAAAACTAACGTGGAAGTTGG + Intronic
1020232533 7:6330812-6330834 CAAAACACTCTGTTGGAGCAGGG + Exonic
1021585729 7:22205601-22205623 AAAAACAGTAATTTGGAGCTAGG + Intronic
1022956840 7:35389037-35389059 CACCACAGAAAGGTGGAGCTGGG + Intergenic
1023647888 7:42337809-42337831 CAAAACCCTTTGCTGGAGCTGGG - Intergenic
1025223169 7:57133569-57133591 AAAAAGAAAAAGGTGGAGCTGGG + Intronic
1025604118 7:63026608-63026630 TAAAAAACTAAGGGGGGGCTGGG + Intergenic
1029699837 7:102239180-102239202 CAAAACACTAAGATGAGGCTGGG - Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1036490256 8:9218582-9218604 TCAAACACTAATTTGGAGCTTGG - Intergenic
1036791117 8:11720944-11720966 CAAATCACGCATGTGGAGCTGGG - Intronic
1037848693 8:22307961-22307983 CAAAGCACTATGGTGTTGCTTGG - Exonic
1037944498 8:22979029-22979051 CAAAACACAAAGTTGCAACTTGG - Intronic
1038528459 8:28297123-28297145 CAAAACAGCAGGGTGGAGCCAGG + Intergenic
1041521200 8:58757947-58757969 CAAAACACTGAGATGGAGTTTGG - Intergenic
1044490139 8:92803888-92803910 CAAAACACTAGAGTAGAGGTAGG + Intergenic
1045765301 8:105660714-105660736 CAATACTTTAATGTGGAGCTAGG - Intronic
1047165621 8:122435101-122435123 CAAAATTCTAACCTGGAGCTTGG + Intergenic
1047216890 8:122883206-122883228 CAAAACCATAAGGTGGAACCAGG - Intronic
1056088758 9:83184171-83184193 CCAATCACTAAGGTAGGGCTTGG + Intergenic
1056434537 9:86562766-86562788 CAAAGCACTGAGCAGGAGCTTGG + Intergenic
1061177265 9:129005269-129005291 CAAGAAATGAAGGTGGAGCTTGG - Intronic
1061739097 9:132686454-132686476 GAAAACACAAAGGAGGAGGTTGG - Intronic
1062608126 9:137357644-137357666 ACAGACACTAAGCTGGAGCTTGG - Intronic
1185978846 X:4752968-4752990 CTTGACACTAATGTGGAGCTTGG + Intergenic
1186330236 X:8524807-8524829 CAAATCACTAAGGTGGGGGTGGG - Intergenic
1189268638 X:39735395-39735417 CAAATCATTAGGGTGGAGGTGGG + Intergenic
1198674509 X:139117912-139117934 CAAGGCACTAAGCTGGGGCTAGG + Intronic