ID: 1095724987

View in Genome Browser
Species Human (GRCh38)
Location 12:45441849-45441871
Sequence CCAAAGCCTGTATTTCTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 269}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095724987 Original CRISPR CCAAAGCCTGTATTTCTTTA GGG (reversed) Intergenic
901327484 1:8376729-8376751 GCAGAGCCCGTATCTCTTTAGGG - Intronic
906063834 1:42965918-42965940 TCAAAGCCTGATTTTCTTCAGGG + Intergenic
907500425 1:54875595-54875617 CCAAAGCCTCTTCTTCTTCAGGG - Intronic
908932091 1:69329589-69329611 TCAGAGTCTCTATTTCTTTATGG + Intergenic
909351043 1:74653729-74653751 CCTAAGGCAATATTTCTTTATGG + Intronic
909650116 1:77965752-77965774 CCCCAGCCTGATTTTCTTTATGG - Intronic
909698753 1:78496193-78496215 CTTAAGCCTGTATTTTTATAAGG - Intronic
911006889 1:93235343-93235365 CCAAAGTAAGTATTTCATTAAGG + Intronic
912343817 1:108944992-108945014 CCAAACCCTGTATTTATTATAGG - Intronic
913377853 1:118174123-118174145 CCAATGTGTGTATTTCTTCAAGG - Intronic
913518013 1:119621886-119621908 CCACACCCAGTATTTCTTTCAGG - Exonic
913550919 1:119916091-119916113 CCAAAGGCTGCATTTCATGAAGG + Exonic
913608867 1:120491703-120491725 CTAAAGCATTTATTTCTTTCTGG + Intergenic
913986569 1:143570961-143570983 CTAAAGCATTTATTTCTTTCTGG - Intergenic
914204962 1:145518748-145518770 CTAAAGCATTTATTTCTTTCTGG - Intergenic
914582326 1:149030135-149030157 CTAAAGCATTTATTTCTTTCTGG - Intronic
916311621 1:163404918-163404940 CCAAAGCCTGCAGTTCTAGAAGG - Intergenic
916719766 1:167475511-167475533 CTAGAGCCTCTATTTCATTAGGG - Intronic
917251343 1:173064719-173064741 CTGAAGTCTGTGTTTCTTTAGGG - Intergenic
917967060 1:180185525-180185547 GCAGGGCCTGTATTTCTTTCAGG - Intronic
918345233 1:183602023-183602045 CTAAAGTCTGTATTTCTTACAGG + Intergenic
918668655 1:187184771-187184793 ACAAAGCCTGTATTTCTTCAGGG + Intergenic
919167262 1:193911115-193911137 TCAAATCCAGTAATTCTTTAAGG + Intergenic
921949791 1:220917446-220917468 CCAAAGCGTTTATTTCTAGAGGG + Intergenic
923261987 1:232276303-232276325 AGACAGCCTATATTTCTTTAAGG + Intergenic
1063889613 10:10616144-10616166 CCTAAGCCTGTATTTCTCCTAGG + Intergenic
1064730804 10:18328888-18328910 CCAAAGACTGTATTTATGTTGGG + Intronic
1065881518 10:30041281-30041303 GCAAAGCCTCTCTTTCTTGAGGG - Intronic
1068428548 10:56900897-56900919 TCTAAGTCTGTATTTTTTTAAGG + Intergenic
1071504674 10:86225485-86225507 TCAAAGCGTGTATTTCTGCAGGG + Intronic
1071882579 10:89915601-89915623 CCTAAGTCTGTATTTCTTTAGGG + Intergenic
1072102073 10:92239197-92239219 CCGAAGCCTCCAGTTCTTTAGGG - Intronic
1072881128 10:99231047-99231069 CCAAAGCATGTAGGTGTTTAAGG - Intronic
1074704439 10:116118597-116118619 AGAGAGCCTGTATTTCTTTGGGG - Intronic
1075284633 10:121172588-121172610 CAAAAGCCTGTATGTCTGTGTGG + Intergenic
1075788999 10:125069940-125069962 CCAAAGTCTGTAGTTACTTAGGG - Intronic
1075928613 10:126273989-126274011 CCAAATCCTGTGTTCCTTTCTGG + Intronic
1076136905 10:128051454-128051476 CCCAAGCCTGTCTTCCTTTATGG - Intronic
1076536709 10:131182930-131182952 CCCAAGCCTGGATTTGTTAAAGG - Intronic
1080574027 11:33581945-33581967 AAAAAGCATGTATTTATTTAGGG + Intronic
1082955100 11:58862789-58862811 CATAAGCCTTTATTTCTTTAGGG + Intronic
1082999911 11:59281756-59281778 CCAAAACCTTTATTTCTGAAGGG - Intergenic
1085798317 11:79564170-79564192 CCATAGCCTGTGTTTCTCCAAGG - Intergenic
1086536185 11:87849570-87849592 TCAAAACCTGTATTATTTTAGGG - Intergenic
1086918182 11:92555493-92555515 CCAAATCTAGTTTTTCTTTAAGG + Intronic
1090407198 11:126483742-126483764 CCAAAGCGTGTATTTGTAAAAGG - Intronic
1091655890 12:2346658-2346680 GCAAAGCCTGTACTTCATCACGG - Intronic
1092874370 12:12835296-12835318 CCACAGCCTGTGGTTCTTTCTGG - Intergenic
1093259165 12:16913701-16913723 CCAGATTCTGTATTTCTTCATGG + Intergenic
1093713704 12:22356661-22356683 TCAAAGCCTGTTTTTGTTTTGGG + Intronic
1095724987 12:45441849-45441871 CCAAAGCCTGTATTTCTTTAGGG - Intergenic
1096031432 12:48419179-48419201 AAAAAGCCTGCATTTCTTTAGGG - Intergenic
1097980369 12:65731980-65732002 CCAAACGCTGTATATCTCTAGGG - Intergenic
1098107846 12:67089451-67089473 CCAAATTCTTTATTTCATTAGGG - Intergenic
1098517995 12:71400514-71400536 CAAAACTCTTTATTTCTTTAGGG + Intronic
1098720456 12:73891176-73891198 CAAAAGACAGTATTCCTTTAAGG - Intergenic
1099039836 12:77638323-77638345 GCAAAGCCTATCTTTCTTCAGGG - Intergenic
1099092447 12:78330270-78330292 CCATGGCCTGTAATTTTTTATGG + Intergenic
1100116766 12:91315132-91315154 CAAAATCCTGTTTTTCATTATGG + Intergenic
1101141951 12:101804703-101804725 CCAAAATCTGTATTTCTATTTGG - Intronic
1103098273 12:118149435-118149457 CCACAGCCTGCTTTTCTTTAAGG + Intergenic
1104048938 12:125183792-125183814 CCTAAGCCTGTATCTCTAAAGGG - Intergenic
1104111235 12:125706656-125706678 CCAAAGCTAAAATTTCTTTAAGG + Intergenic
1107792854 13:44019562-44019584 CCTAACTCTGTATTTCTGTAAGG + Intergenic
1110015591 13:70397257-70397279 CCAAAGTCCTTATGTCTTTAAGG + Intergenic
1111002348 13:82201571-82201593 CAAAAGCCTGAAATTCTTTTTGG - Intergenic
1112837736 13:103536340-103536362 CGAAAGCCTGCATTTCCTTTGGG - Intergenic
1113162894 13:107402667-107402689 CCAAAGCCTGTATTTTTCAGTGG - Intronic
1113208317 13:107942977-107942999 CATAATCCTGTATTTCTTCAAGG - Intergenic
1113375125 13:109758166-109758188 CAAATGCCTGTTTTTTTTTAGGG - Intronic
1113898757 13:113784082-113784104 CCAAAGCGTTTAGTTTTTTATGG - Intronic
1115225769 14:31100367-31100389 CCAAACTTTTTATTTCTTTAAGG - Exonic
1119961067 14:78857474-78857496 AGAAAGCTTGGATTTCTTTAAGG - Intronic
1121301599 14:92875949-92875971 CCACAGGCTGTATTTCTGAATGG - Intergenic
1121953752 14:98195661-98195683 GCAAAGCTTGTATCTTTTTAAGG + Intergenic
1123191690 14:106578098-106578120 CCAGAGTTTTTATTTCTTTATGG + Intergenic
1124972859 15:34506638-34506660 CCAGATCCAGTATTTCTTAATGG + Intergenic
1125550125 15:40538806-40538828 CAAAAGCCTTTATTGCTCTAAGG - Intronic
1126075403 15:44904269-44904291 CCAAATCCTGTCCTTCTTTCAGG - Intergenic
1126082968 15:44983518-44983540 CCAAATCCTGTCCTTCTTTCAGG + Intergenic
1127336086 15:57985937-57985959 CCAAATCCAGTATGTCCTTATGG + Intronic
1127816100 15:62610303-62610325 CCCAAGCCTGTATTTCTCCTAGG - Intronic
1128600522 15:68991709-68991731 CCAAACCCTGTCTTTGTTCAGGG - Intronic
1130580430 15:85132909-85132931 CCAGTGCCTGTACATCTTTAGGG + Intronic
1131946024 15:97622887-97622909 CCATAGCCTGTTTTTTTTAAAGG - Intergenic
1132088801 15:98930526-98930548 CTAAAGCCTGTGTTTCCTTGGGG - Intronic
1132112015 15:99108466-99108488 CCCAAGCCTGTAATTTTTTTCGG + Intronic
1132187535 15:99815012-99815034 CCATATCCAGTATTTCTTAATGG - Intergenic
1134363883 16:13558445-13558467 CCCAACCCTGTATTTCTCTTAGG - Intergenic
1135229237 16:20690128-20690150 CCAAAGCCTACATGCCTTTATGG - Intronic
1135338011 16:21620440-21620462 TCAAAGCATGGATTTTTTTAAGG - Intronic
1136709441 16:32223755-32223777 CCTAAGCCTCTTGTTCTTTAGGG + Intergenic
1136758469 16:32705664-32705686 CCTAAGCCTCTTGTTCTTTAGGG - Intergenic
1136809639 16:33164715-33164737 CCTAAGCCTCTTGTTCTTTAGGG + Intergenic
1136816115 16:33274795-33274817 CCTAAGCCTCTTGTTCTTTAGGG + Intronic
1138982324 16:62284637-62284659 CCAAAGCACATATCTCTTTAGGG + Intergenic
1141930771 16:87201246-87201268 CCAAAGCCTGTACATTTTTCAGG + Intronic
1203060622 16_KI270728v1_random:965994-966016 CCTAAGCCTCTTGTTCTTTAGGG - Intergenic
1143177499 17:4964659-4964681 CCAAATCCTTTACATCTTTAAGG + Intronic
1146137309 17:30334144-30334166 TCAAAGTCTGTTTTTCTTTATGG + Intergenic
1147331691 17:39703117-39703139 CCAATGCCTGTCTTCCTTTTGGG + Intronic
1149626895 17:58085799-58085821 CCCAAGCCTCTGTTTTTTTAGGG + Intronic
1157302601 18:46489917-46489939 CCAAAGCTGCTATTTCTTTTGGG + Intronic
1157465078 18:47936927-47936949 AGACAGGCTGTATTTCTTTAAGG - Intergenic
1157763055 18:50278761-50278783 CCTAACCCTGTATTTCTTCTAGG - Intronic
1157791581 18:50536410-50536432 TCAAAGCCTGTAATTCTTTTAGG - Intergenic
1158409040 18:57188024-57188046 CCCAAACTTGTATTTCTTTGGGG - Intergenic
1158465169 18:57683544-57683566 CCTCAGCCTGGATCTCTTTAAGG - Intronic
1159242323 18:65758208-65758230 AAAAAGCCTGTAGTTCTTTGTGG - Intronic
1159645994 18:70919123-70919145 GCATATCCTGTATTTCTCTATGG + Intergenic
1159780753 18:72657977-72657999 TCAAAGCCTGTACTTCTATTGGG + Intergenic
1160017584 18:75156486-75156508 CCAAAGCCTTCCTTTCTTTAGGG + Intergenic
1164532761 19:29060746-29060768 ACAAGGCCTGCATTTCTTAATGG + Intergenic
1164594214 19:29523231-29523253 CCAAAGCCTGTCTTACTCTGGGG - Intergenic
1165564373 19:36711824-36711846 CCAAAAACTGTATTTATTTATGG - Exonic
1168585516 19:57588444-57588466 CCAGGGCCTGTATTTCCTTAAGG + Intronic
925495986 2:4449837-4449859 CCCAAGACTGCATTTCTTCATGG - Intergenic
925782145 2:7390848-7390870 CCAGAGTCTGTATTTCTGAAAGG + Intergenic
927287234 2:21369559-21369581 CCACTGCCTGTATGCCTTTAGGG + Intergenic
927976341 2:27341405-27341427 ACAAAGGCTGTTTTTGTTTATGG - Intronic
928428199 2:31196680-31196702 GCAAAACCCGCATTTCTTTAGGG + Intronic
928844883 2:35659232-35659254 ACAAAGCATGTATTTATTTTTGG - Intergenic
930294108 2:49531592-49531614 CCAAAGTCTCCTTTTCTTTAAGG - Intergenic
930464554 2:51731103-51731125 CCAGAGTCTGCATTTCTTTCTGG + Intergenic
932329926 2:70892546-70892568 CCAGAGACTGTATTCCTATAAGG + Intergenic
932897821 2:75660339-75660361 CCAATGTCTGTGTTTCTTCAGGG + Intronic
933274622 2:80270265-80270287 CTAAATCCTCTATTTTTTTAGGG + Intronic
933319908 2:80760302-80760324 CCAAACCTTATATTTCTTTCAGG - Intergenic
933515347 2:83293877-83293899 CTGAAACCTGTGTTTCTTTAGGG + Intergenic
933875826 2:86621342-86621364 CCAAAGCCATCATTTTTTTATGG - Intronic
935095031 2:99936121-99936143 CCAAAGGCTGTAGTTCCTGAGGG - Intronic
935217567 2:100986507-100986529 CCTTAGCCTGGAGTTCTTTAGGG - Intronic
936748974 2:115617234-115617256 CCAAACCCTGTATGTATGTATGG + Intronic
936993188 2:118387371-118387393 CAAAAGGCTGCATTTCTTCATGG + Intergenic
937777393 2:125794698-125794720 CCAATGCCTGTGTTGCTTCAGGG - Intergenic
939641756 2:144648113-144648135 CCGAAGTCAGTATTTCTGTATGG + Intergenic
939668981 2:144986398-144986420 CTGAAGCCTGTGTTTCTTCAGGG + Intergenic
941064980 2:160891762-160891784 CCAAAGGCTGTCTTTATTAAAGG + Intergenic
941296908 2:163750115-163750137 GCTAAGCCTGTCTTTCTTTATGG + Intergenic
941433479 2:165439078-165439100 CCACAGCCTGTGTTTCTTTCAGG + Intergenic
941932334 2:170954592-170954614 TCACAGCTTGTATTTCTTTGAGG - Intronic
942164317 2:173227332-173227354 TCTAAGCCTTTCTTTCTTTAGGG - Intronic
942953090 2:181744133-181744155 GAAAAACCTGTATTTCTTAATGG + Intergenic
944016396 2:195044563-195044585 CCAAACCTTGTATTTATTTCTGG + Intergenic
944364685 2:198904034-198904056 CCAAAGCCTGAATTTCATTTAGG + Intergenic
946377167 2:219318475-219318497 CCAACGCCTGTATTTTTTTTGGG + Intergenic
946856936 2:223959558-223959580 CAAAAGCTTGTATTTCTGCATGG - Exonic
1168797159 20:618913-618935 CCTAAGCCTGTATTTCTCCTAGG - Intergenic
1168847864 20:957886-957908 CCAAAACCTGAATTTCTAAAAGG + Intergenic
1169559519 20:6784987-6785009 CTAAAGCCTGTATATCTGAATGG - Intergenic
1169602908 20:7282672-7282694 CTAAATCCTGTTTTTCTTTATGG - Intergenic
1169678808 20:8186151-8186173 CCAAAGTTTGGATTTCTTTTTGG + Intronic
1169820532 20:9704789-9704811 CCACTGGCTGTATTTCTTCATGG - Intronic
1169950845 20:11041584-11041606 ACAAAGCCTGCATTACTTTAAGG - Intergenic
1171445759 20:25203723-25203745 CCAGTGCCTGCATTTCTTCAGGG + Intronic
1172435083 20:34923211-34923233 CCAAAGCCTGTACTTCATTCAGG + Intronic
1172524426 20:35590059-35590081 CCTAACCCTGTATTTCTCTGGGG + Intergenic
1173068107 20:39734066-39734088 CCATAGTCTGCATTTCTTTGTGG - Intergenic
1173859700 20:46275142-46275164 CAAAAGCCAGTGTTTCTATAAGG + Intronic
1176938781 21:14899007-14899029 TCAAAGTCTGTATCCCTTTATGG + Intergenic
1178189708 21:30266316-30266338 CCAAACCTTGTATTTCTATGTGG - Intergenic
1178802623 21:35810397-35810419 CCAAAGAAGGTTTTTCTTTAAGG - Intronic
1179670131 21:42941075-42941097 CCAAAGTCTGTTTTTCTTGGCGG + Intergenic
1180211784 21:46299267-46299289 CCCAACCCTTTGTTTCTTTAGGG + Intergenic
1182064757 22:27422685-27422707 TCAAAGCCTTTAATGCTTTAAGG + Intergenic
1182806035 22:33071294-33071316 CCAGACACTGTATTTCTTAAAGG - Intergenic
1184435550 22:44472696-44472718 AAAAACCCTGTATTTCATTAAGG + Intergenic
950390920 3:12696187-12696209 CCAAAGCCTGTGATTTTCTAAGG + Intergenic
950879809 3:16314174-16314196 CCAAACCCTGTATGTCTTTGTGG + Intronic
951100442 3:18682328-18682350 CCAAACCCTCTATTTCTCTGAGG - Intergenic
951225472 3:20116127-20116149 CCAAAACCTGTAGTGCTTTGGGG + Intronic
952431938 3:33232251-33232273 TCAAAGCCTGTCTTCCTTTGGGG - Intergenic
953178312 3:40572643-40572665 GAAAAGCCTTTATTTCTGTACGG + Intronic
953195120 3:40724970-40724992 CCAAAGCAGCTATGTCTTTAGGG + Intergenic
953890720 3:46750147-46750169 CCAAAGCCTGTGTTTTCTGAGGG + Intronic
954346114 3:50000975-50000997 CCTAAGCCTGTCATTCTTTAAGG - Intronic
959248650 3:103909485-103909507 TCAAAGCCTAATTTTCTTTATGG + Intergenic
959927734 3:111942959-111942981 CCCAACCCTGTATTGTTTTAGGG + Intronic
962307056 3:134297820-134297842 CCTAACCCTGTATTTCTCTCAGG - Intergenic
964944270 3:162200480-162200502 CCTAACCCTGTATTTCTTCTAGG - Intergenic
965004936 3:163008491-163008513 TGAAAGCATGTATTTCTTTATGG + Intergenic
965687677 3:171322168-171322190 CCAAAAGCTGTATTTCACTAAGG + Intronic
966260804 3:177976559-177976581 CCACATCTTGTATATCTTTATGG - Intergenic
968156917 3:196388844-196388866 CAAAAGCAGGTATTTCATTATGG - Intronic
968380216 4:88176-88198 CCAAAGTCTGCATTTATTTGCGG - Exonic
971547846 4:27909905-27909927 CCAAATCCTGGATTTCTGGATGG + Intergenic
971931884 4:33095086-33095108 CCAGAGTGTGTACTTCTTTATGG + Intergenic
972625575 4:40795664-40795686 CCTAAGACAGTATTTCCTTATGG - Intronic
972964132 4:44488065-44488087 CCTAATCCTGTATTTCTTCTAGG - Intergenic
973167547 4:47096198-47096220 CCAAACCCTATATTGCTTTTAGG + Intronic
973300783 4:48581443-48581465 ATAAAGCCCGTATTTCTCTAAGG + Exonic
975470490 4:74760542-74760564 TCAAAGTTTGTATTTCTTCAAGG - Intronic
976805213 4:89038212-89038234 CAATGGCCTGTATTTCCTTATGG + Intronic
979114815 4:116810073-116810095 TCCAGGCCTGTATTTCTTTCTGG + Intergenic
979604058 4:122618378-122618400 CCAATGCCTGTAATCCTTTTGGG - Intronic
980279054 4:130694147-130694169 CAACAACCTGTATTTCTTTCTGG + Intergenic
980461053 4:133114174-133114196 CCACAGCTTGTATTGCTCTAAGG - Intergenic
980897348 4:138872706-138872728 CCAAGACCTGTAACTCTTTAAGG + Intergenic
981176220 4:141687109-141687131 CCAAAACCTGAACTTCTCTAAGG - Intronic
982073398 4:151715735-151715757 TCAAAGCCATTATTTCATTAAGG + Intronic
982533949 4:156585163-156585185 CCAAAGCCTGTAAATTTTTTTGG + Intergenic
983541152 4:168912010-168912032 CTAAAACCTGGACTTCTTTAGGG - Intronic
983910966 4:173238749-173238771 CCAAAGCATGAATTTTTATAAGG + Intronic
984283022 4:177694934-177694956 CCAAAGCAAGTATTTCTCAAAGG + Intergenic
985306330 4:188545262-188545284 CCAAATCCCCTATTTCCTTAAGG - Intergenic
986468123 5:8047430-8047452 CCAAAGCCTGAAGTTGTTTATGG - Intergenic
986598209 5:9445221-9445243 CCAAAGGCTGAATTCCTTGAGGG - Intronic
987168780 5:15230836-15230858 CCAATGCCTATGTTTCTTCAGGG + Intergenic
991480102 5:67068681-67068703 AAAATGCCTGTATTTCTTTTTGG - Intronic
991695501 5:69267061-69267083 CCAAAGCAGCTCTTTCTTTAGGG + Intronic
991775930 5:70085640-70085662 CCTAACCCTGTATTTCTGTTAGG + Intergenic
991855218 5:70961094-70961116 CCTAACCCTGTATTTCTGTTAGG + Intergenic
992721885 5:79569173-79569195 CCAAAGCCTGGATTACTGTTTGG + Intergenic
995739447 5:115339723-115339745 TGAGAGCCTGTATTTCTCTATGG - Intergenic
995750703 5:115450676-115450698 TGAAAGCCTGTTTTTGTTTAGGG - Intergenic
997904962 5:137807419-137807441 CCAACTTCTGTATTTTTTTAGGG - Intergenic
999465936 5:151804496-151804518 TCAAATCCTGTATTTCTTACAGG - Exonic
1000341599 5:160281018-160281040 CCAATGCCTTTATTCCTTTATGG - Intronic
1000635143 5:163635433-163635455 GCAAGGCCTATATTTCTATAAGG - Intergenic
1003197039 6:3924502-3924524 CCTAACCCTGTATTTCTCTTGGG - Intergenic
1003625706 6:7739417-7739439 ACAAGTACTGTATTTCTTTATGG + Intronic
1005324658 6:24687631-24687653 CTCAAGCCTGTATGTCTTTAAGG - Intronic
1005820163 6:29591945-29591967 CAAAATCCTGTGTTTCTTCAAGG + Intronic
1007499233 6:42282824-42282846 CCTAACCCTGTATTTCTCTTAGG - Intronic
1008377364 6:50807347-50807369 GCAAAGCATTTATTTCTTTTAGG + Intergenic
1010318492 6:74478641-74478663 CCATAGACTATATTTCTTGAGGG + Intergenic
1010447173 6:75961262-75961284 CCAACTCCTTTATATCTTTAAGG + Intronic
1010567657 6:77436489-77436511 CCAAAACCTTTAATTTTTTAAGG - Intergenic
1012818329 6:104053377-104053399 TTAAAGCATGTATTGCTTTATGG - Intergenic
1015233799 6:130947433-130947455 GCAAATATTGTATTTCTTTATGG - Intronic
1016640347 6:146341088-146341110 CCAAAGCCTGTGTTAGTTGAGGG - Intronic
1017455609 6:154598460-154598482 CAACAGCCTGTATTGCTTTCAGG - Intergenic
1018884944 6:167927462-167927484 CTAAATCCTGCATTTCTTTGTGG - Intronic
1019866770 7:3719108-3719130 CCCAAGTCTGTATTTCATTTGGG + Intronic
1020168916 7:5829687-5829709 CCTTTGCCTATATTTCTTTAGGG + Intergenic
1023473326 7:40549418-40549440 CAAATGCTTGCATTTCTTTAAGG - Intronic
1023554276 7:41404329-41404351 CCTAAACCTGTATGTCTGTATGG + Intergenic
1024161958 7:46685235-46685257 CCAAAGCGTGGATGCCTTTAGGG + Intronic
1026394110 7:69934361-69934383 CCAAAGACTGTATTTCTAGTTGG + Intronic
1026579733 7:71605038-71605060 CCAAAGCATTTATTTGTTTGTGG - Intronic
1027610305 7:80352038-80352060 CCAAAACCTTCATTTCTTAAGGG + Intergenic
1027659626 7:80973805-80973827 CCAAAGCCTATTTTCCTTAATGG + Intergenic
1027883179 7:83869304-83869326 CATAAGCCTGTTGTTCTTTATGG + Intergenic
1029344497 7:99968516-99968538 CAAAAACCTTTATTTCTTTTGGG - Intronic
1030567036 7:111170506-111170528 CCACAGGCTTTATTTCTTAAGGG - Intronic
1031814392 7:126415143-126415165 CAAAACCTTGTATTTCTTTTGGG - Intergenic
1032354887 7:131201626-131201648 CAAATGCCTGCATTTGTTTAGGG + Intronic
1032471712 7:132183812-132183834 GCAAAGCCTGTCTTTCTTTTGGG + Intronic
1033104496 7:138508427-138508449 CAAGATCCTGTATTTCATTAGGG + Intronic
1035516557 8:238497-238519 CAGAAACCTGTATTTCTTTATGG - Intronic
1036424581 8:8631834-8631856 CAAAAGTCTGTGTTTCTTTTGGG + Intergenic
1036430894 8:8689471-8689493 GCATGGCCTGTCTTTCTTTATGG - Intergenic
1037068337 8:14611988-14612010 ACAAGGCATCTATTTCTTTAAGG + Intronic
1037391220 8:18393791-18393813 CCAAATCCTGAATTTTTTTCTGG - Intronic
1038688621 8:29741297-29741319 CCACAACCTGTCTTCCTTTAGGG - Intergenic
1039712670 8:40072087-40072109 CAAAACCCTGAATTTCTTCAGGG + Intergenic
1040958252 8:53002832-53002854 ACGAAGCCAGTATTTCCTTATGG - Intergenic
1040984286 8:53277021-53277043 CCCAAGTCTGTATTTGTTTGGGG + Intergenic
1042509363 8:69595170-69595192 CCAAAGTCTATATTTTTTAAAGG + Intronic
1042795400 8:72656992-72657014 CCACAGGCTCTATTTCATTAGGG + Intronic
1043751860 8:83947069-83947091 CAAAAACCTATAATTCTTTAAGG + Intergenic
1045684451 8:104697677-104697699 CCAGAGCCTGTATTTGATTTTGG - Intronic
1045843177 8:106603093-106603115 TCATAGCCTGTATATCTTGAAGG + Intronic
1047096244 8:121629142-121629164 CCAAAGCCTGTTTGCCTTTTTGG - Exonic
1047347475 8:124042116-124042138 CCAAATCCTGTACTTCACTAAGG - Intronic
1047448439 8:124940324-124940346 CCAAGGACTGTATTTCTGAAGGG - Intergenic
1048451382 8:134536746-134536768 CCAAAACCTGTATATATTTAGGG - Intronic
1048515845 8:135110653-135110675 CCTAACCCCATATTTCTTTAAGG + Intergenic
1050361676 9:4836564-4836586 CCACAGCCTGTCTTGCTCTACGG - Intronic
1051928729 9:22360390-22360412 CCCAAGCCTCTCTTTCTTAATGG + Intergenic
1052537477 9:29765559-29765581 CAAAATCCTGCATCTCTTTATGG + Intergenic
1055840215 9:80494319-80494341 CCAAATCCTGCATTTCTGTTTGG + Intergenic
1056536566 9:87533235-87533257 TCAAAGCCTGCATTACTTTATGG - Intronic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1057347462 9:94263116-94263138 TCAAATCTTGTATTTCCTTATGG + Intronic
1057384094 9:94592299-94592321 CCACAGACTGTATTTATTTAGGG - Intronic
1057456688 9:95219570-95219592 GTCAAACCTGTATTTCTTTAGGG - Intronic
1057539166 9:95948880-95948902 CCAATGCCTGTTTTGCTTCAGGG - Intronic
1057599877 9:96449019-96449041 CCAGAGCCTGTATTTTGTTCAGG - Intergenic
1058391784 9:104503707-104503729 CCAAAGTCTCTGTTACTTTATGG + Intergenic
1058868780 9:109185192-109185214 CCAAAGCATATATTTCTCTCTGG + Intronic
1060425081 9:123497754-123497776 AAATAGCCTGTATTTCTATATGG - Intronic
1061180927 9:129024708-129024730 CCAAAGTCTTTCTTTTTTTAAGG - Intronic
1186058381 X:5676012-5676034 CCAAAGCCTTTGTTTCCTTTAGG + Intergenic
1186498782 X:10033907-10033929 CCAAAGTCTGCATTTTCTTAAGG + Intronic
1187008841 X:15259325-15259347 CCAAAGTCTGTATTTCATGCAGG - Intronic
1189740931 X:44116627-44116649 CCAATGCCCTGATTTCTTTAGGG + Intergenic
1190378859 X:49818442-49818464 CTTAAGCCTTTATTTCTGTAAGG + Intergenic
1192961890 X:76139754-76139776 CAAAAGCCTGGATCTGTTTAAGG + Intergenic
1195884749 X:109626175-109626197 TCAAAGGCTGTCTTTTTTTAGGG + Intronic
1196260970 X:113581186-113581208 CCAATGCCTATGTTTCTTTATGG + Intergenic
1198081979 X:133248780-133248802 GAAAAGCCTGAATTTCATTAAGG + Intergenic
1198615494 X:138453950-138453972 CCAAAACCTGTTTCTCTATAGGG - Intergenic
1199792036 X:151164351-151164373 CCAAATCCTGATTGTCTTTAGGG - Intergenic
1201791460 Y:17845693-17845715 CCAATTCTTTTATTTCTTTATGG + Intergenic
1201799365 Y:17938346-17938368 CCAATTCCTTTATTTCTTTATGG + Intergenic
1201802188 Y:17967610-17967632 CCAATTCCTTTATTTCTTTATGG - Intergenic
1201810094 Y:18060296-18060318 CCAATTCTTTTATTTCTTTATGG - Intergenic
1202362179 Y:24122296-24122318 CCAATTCCTTTATTTCTTCATGG - Intergenic
1202362894 Y:24130800-24130822 CCAATTCCTTTATTTCTTCATGG + Intergenic
1202507884 Y:25539315-25539337 CCAATTCCTTTATTTCTTCATGG - Intergenic
1202508600 Y:25547819-25547841 CCAATTCCTTTATTTCTTCATGG + Intergenic