ID: 1095727573

View in Genome Browser
Species Human (GRCh38)
Location 12:45470078-45470100
Sequence ACCACAGATCTCCCCAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095727571_1095727573 -3 Left 1095727571 12:45470058-45470080 CCACCTAGAAGGCTTGTGCAACC No data
Right 1095727573 12:45470078-45470100 ACCACAGATCTCCCCAGCCCCGG No data
1095727572_1095727573 -6 Left 1095727572 12:45470061-45470083 CCTAGAAGGCTTGTGCAACCACA No data
Right 1095727573 12:45470078-45470100 ACCACAGATCTCCCCAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095727573 Original CRISPR ACCACAGATCTCCCCAGCCC CGG Intergenic
No off target data available for this crispr