ID: 1095729673

View in Genome Browser
Species Human (GRCh38)
Location 12:45492989-45493011
Sequence CACTTTCTCCAGAGGCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095729664_1095729673 25 Left 1095729664 12:45492941-45492963 CCTAGTTCTGGAGGCCAGAAGTT No data
Right 1095729673 12:45492989-45493011 CACTTTCTCCAGAGGCTCTAGGG No data
1095729667_1095729673 11 Left 1095729667 12:45492955-45492977 CCAGAAGTTGGAAATCAAGGTGT No data
Right 1095729673 12:45492989-45493011 CACTTTCTCCAGAGGCTCTAGGG No data
1095729663_1095729673 29 Left 1095729663 12:45492937-45492959 CCATCCTAGTTCTGGAGGCCAGA 0: 2
1: 7
2: 27
3: 109
4: 266
Right 1095729673 12:45492989-45493011 CACTTTCTCCAGAGGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095729673 Original CRISPR CACTTTCTCCAGAGGCTCTA GGG Intergenic
No off target data available for this crispr