ID: 1095736262

View in Genome Browser
Species Human (GRCh38)
Location 12:45559581-45559603
Sequence TGCATTATGAAGGAACTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095736257_1095736262 18 Left 1095736257 12:45559540-45559562 CCTATGTAATCAGATTCCAATTG No data
Right 1095736262 12:45559581-45559603 TGCATTATGAAGGAACTGGAGGG No data
1095736258_1095736262 2 Left 1095736258 12:45559556-45559578 CCAATTGTGAAAAGATAATTCTG No data
Right 1095736262 12:45559581-45559603 TGCATTATGAAGGAACTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095736262 Original CRISPR TGCATTATGAAGGAACTGGA GGG Intergenic
No off target data available for this crispr