ID: 1095742348

View in Genome Browser
Species Human (GRCh38)
Location 12:45621192-45621214
Sequence CCATTGCCATAGAGGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095742338_1095742348 22 Left 1095742338 12:45621147-45621169 CCCTTTTAGTTCTTCTAACAGCT No data
Right 1095742348 12:45621192-45621214 CCATTGCCATAGAGGGAGCCTGG No data
1095742339_1095742348 21 Left 1095742339 12:45621148-45621170 CCTTTTAGTTCTTCTAACAGCTG No data
Right 1095742348 12:45621192-45621214 CCATTGCCATAGAGGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095742348 Original CRISPR CCATTGCCATAGAGGGAGCC TGG Intergenic
No off target data available for this crispr