ID: 1095743994

View in Genome Browser
Species Human (GRCh38)
Location 12:45636995-45637017
Sequence GGTTTTCAACAGATGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095743989_1095743994 -1 Left 1095743989 12:45636973-45636995 CCATCCAATGTAGAAAAGACATG No data
Right 1095743994 12:45636995-45637017 GGTTTTCAACAGATGGTGCTGGG No data
1095743991_1095743994 -5 Left 1095743991 12:45636977-45636999 CCAATGTAGAAAAGACATGGTTT No data
Right 1095743994 12:45636995-45637017 GGTTTTCAACAGATGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095743994 Original CRISPR GGTTTTCAACAGATGGTGCT GGG Intergenic
No off target data available for this crispr