ID: 1095746637

View in Genome Browser
Species Human (GRCh38)
Location 12:45666730-45666752
Sequence GGGGGTTTCCAGAACTGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095746634_1095746637 -5 Left 1095746634 12:45666712-45666734 CCATTTTTACACCAAACAGGGGG No data
Right 1095746637 12:45666730-45666752 GGGGGTTTCCAGAACTGTCATGG No data
1095746630_1095746637 -1 Left 1095746630 12:45666708-45666730 CCATCCATTTTTACACCAAACAG No data
Right 1095746637 12:45666730-45666752 GGGGGTTTCCAGAACTGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095746637 Original CRISPR GGGGGTTTCCAGAACTGTCA TGG Intergenic
No off target data available for this crispr