ID: 1095749742

View in Genome Browser
Species Human (GRCh38)
Location 12:45697138-45697160
Sequence TGGTGCCCAAAGTTTCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095749733_1095749742 -2 Left 1095749733 12:45697117-45697139 CCCCAGCCTCCCTGAGCTCGTTG No data
Right 1095749742 12:45697138-45697160 TGGTGCCCAAAGTTTCAGAGGGG No data
1095749730_1095749742 8 Left 1095749730 12:45697107-45697129 CCTCAGTTCCCCCCAGCCTCCCT No data
Right 1095749742 12:45697138-45697160 TGGTGCCCAAAGTTTCAGAGGGG No data
1095749736_1095749742 -4 Left 1095749736 12:45697119-45697141 CCAGCCTCCCTGAGCTCGTTGGT No data
Right 1095749742 12:45697138-45697160 TGGTGCCCAAAGTTTCAGAGGGG No data
1095749732_1095749742 -1 Left 1095749732 12:45697116-45697138 CCCCCAGCCTCCCTGAGCTCGTT No data
Right 1095749742 12:45697138-45697160 TGGTGCCCAAAGTTTCAGAGGGG No data
1095749737_1095749742 -8 Left 1095749737 12:45697123-45697145 CCTCCCTGAGCTCGTTGGTGCCC No data
Right 1095749742 12:45697138-45697160 TGGTGCCCAAAGTTTCAGAGGGG No data
1095749731_1095749742 0 Left 1095749731 12:45697115-45697137 CCCCCCAGCCTCCCTGAGCTCGT No data
Right 1095749742 12:45697138-45697160 TGGTGCCCAAAGTTTCAGAGGGG No data
1095749729_1095749742 9 Left 1095749729 12:45697106-45697128 CCCTCAGTTCCCCCCAGCCTCCC No data
Right 1095749742 12:45697138-45697160 TGGTGCCCAAAGTTTCAGAGGGG No data
1095749734_1095749742 -3 Left 1095749734 12:45697118-45697140 CCCAGCCTCCCTGAGCTCGTTGG No data
Right 1095749742 12:45697138-45697160 TGGTGCCCAAAGTTTCAGAGGGG No data
1095749728_1095749742 12 Left 1095749728 12:45697103-45697125 CCACCCTCAGTTCCCCCCAGCCT No data
Right 1095749742 12:45697138-45697160 TGGTGCCCAAAGTTTCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095749742 Original CRISPR TGGTGCCCAAAGTTTCAGAG GGG Intergenic
No off target data available for this crispr