ID: 1095749785

View in Genome Browser
Species Human (GRCh38)
Location 12:45697353-45697375
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 592
Summary {0: 7, 1: 19, 2: 66, 3: 113, 4: 387}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095749785_1095749797 17 Left 1095749785 12:45697353-45697375 CCCTGAGAGTGCAGGGATGCCCA 0: 7
1: 19
2: 66
3: 113
4: 387
Right 1095749797 12:45697393-45697415 GGGTAGCTGCAGCTGCACTTGGG No data
1095749785_1095749798 25 Left 1095749785 12:45697353-45697375 CCCTGAGAGTGCAGGGATGCCCA 0: 7
1: 19
2: 66
3: 113
4: 387
Right 1095749798 12:45697401-45697423 GCAGCTGCACTTGGGAGCCCAGG No data
1095749785_1095749789 -8 Left 1095749785 12:45697353-45697375 CCCTGAGAGTGCAGGGATGCCCA 0: 7
1: 19
2: 66
3: 113
4: 387
Right 1095749789 12:45697368-45697390 GATGCCCAGGTCCGGATCCATGG No data
1095749785_1095749791 -4 Left 1095749785 12:45697353-45697375 CCCTGAGAGTGCAGGGATGCCCA 0: 7
1: 19
2: 66
3: 113
4: 387
Right 1095749791 12:45697372-45697394 CCCAGGTCCGGATCCATGGCTGG No data
1095749785_1095749796 16 Left 1095749785 12:45697353-45697375 CCCTGAGAGTGCAGGGATGCCCA 0: 7
1: 19
2: 66
3: 113
4: 387
Right 1095749796 12:45697392-45697414 TGGGTAGCTGCAGCTGCACTTGG No data
1095749785_1095749793 -3 Left 1095749785 12:45697353-45697375 CCCTGAGAGTGCAGGGATGCCCA 0: 7
1: 19
2: 66
3: 113
4: 387
Right 1095749793 12:45697373-45697395 CCAGGTCCGGATCCATGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095749785 Original CRISPR TGGGCATCCCTGCACTCTCA GGG (reversed) Intergenic
901936462 1:12630400-12630422 AAGGCATCCCTGTACTCTCGGGG + Intergenic
903311964 1:22465718-22465740 CAGGCATCCCTGCACTCTTGGGG - Intronic
903861001 1:26364531-26364553 TGGGCAGCTCTCCAATCTCAAGG - Exonic
904365795 1:30010301-30010323 TAGGCATCCCTGCACTCTTGGGG - Intergenic
904460938 1:30679504-30679526 CTGGCATCCCTGCACTCTTGGGG + Intergenic
904732819 1:32607403-32607425 TGGGCATCCCTGCACTCTTCAGG - Intronic
904850273 1:33454126-33454148 TGGGAATTCCTGCACTGTCTAGG - Intergenic
905125770 1:35715190-35715212 TGTGCACCCCTGCACACACAAGG + Exonic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
906051905 1:42881133-42881155 CAGGCATCCTTGCACTCTCGGGG - Intergenic
906607048 1:47180003-47180025 TGGCCACCCCTGCACTGCCAGGG + Intergenic
907614698 1:55912496-55912518 TGGGCATCCCTGTACTCTTGCGG + Intergenic
907985242 1:59524033-59524055 TGGGCATCCCTACGCTCTCAGGG + Intronic
909054735 1:70807371-70807393 TGGGCATCCCTGTGCTCTCAGGG - Intergenic
909190500 1:72543082-72543104 AGGGCATCCTTGAACTCACATGG + Intergenic
909238399 1:73181198-73181220 CAGGCATCCCTGCACTCTTGGGG - Intergenic
909907735 1:81220660-81220682 CAGGCATCCCTGCACTCTCAGGG + Intergenic
910208027 1:84766861-84766883 TGGGCATCTCTACACTCTCTTGG - Intergenic
910602230 1:89043936-89043958 CAGGCATCTCTGCACTCCCAGGG - Intergenic
910655062 1:89610446-89610468 CGGGCATCTCTGCACTCTCAGGG - Intergenic
910856037 1:91696878-91696900 TGGGCAGCCCAGCACTCCAAAGG + Intronic
911275449 1:95853340-95853362 CAGGCATTTCTGCACTCTCAGGG + Intergenic
911288765 1:96029157-96029179 CAGGCATCTCTGCACTCTCAAGG - Intergenic
911434895 1:97844779-97844801 TGGGCAACCCTGCCTTCTCAGGG + Intronic
911475484 1:98367528-98367550 TGGGCATCCCTGTGCTCTCAGGG - Intergenic
911935259 1:103961170-103961192 TGGACATCCCTGCGCTCTCAAGG - Intergenic
912501986 1:110128863-110128885 TGGGCATCTCTGCAACCTCAGGG - Intergenic
914392832 1:147237277-147237299 TGGGCATCTCTGCACTCTTGGGG - Intronic
914392870 1:147237458-147237480 TGGGCATCCCTGTGCTCTTTGGG - Intronic
915334729 1:155134440-155134462 TGGGCATCCTGGCTCTCTCCTGG - Exonic
915916507 1:159943902-159943924 TGGGGATGCCTGCATTCTGAGGG + Intronic
917609969 1:176679092-176679114 TGGAAACTCCTGCACTCTCATGG + Intronic
917834864 1:178933537-178933559 TGGCCTTCCCTGGCCTCTCAGGG - Intergenic
917838375 1:178958588-178958610 TGGGCATCCCTGGCCGCTCCTGG - Intergenic
917931275 1:179824422-179824444 GAGGCAACCCTGAACTCTCAGGG + Intergenic
918247755 1:182674946-182674968 TGGGAAGCCCTGCCCTCTCCAGG + Intronic
919205827 1:194420785-194420807 CTGGCATCCCTGCCTTCTCAAGG - Intergenic
919249252 1:195030981-195031003 TAGGCATCCCTGTGCTCTCAGGG - Intergenic
919253787 1:195096131-195096153 TCGGCATCCCTGCACTCTAGGGG + Intergenic
919263919 1:195237433-195237455 CAGGCATCCCTGTATTCTCAGGG + Intergenic
919302662 1:195790727-195790749 CTGGAATTCCTGCACTCTCAGGG + Intergenic
921097701 1:211901490-211901512 TGGGTATCTCTGCACTCTTGGGG + Intergenic
921410571 1:214832192-214832214 TGAGCATGCCTGAACTGTCAGGG - Intergenic
922243877 1:223776382-223776404 TTGGGACTCCTGCACTCTCATGG - Intergenic
922423506 1:225474580-225474602 TGGCCAGCCCGGCACTCTCTAGG + Intergenic
1062770128 10:92508-92530 CAGGCATCCCTGCACTCTTGGGG - Intergenic
1063232958 10:4083957-4083979 TGCACATCCCTGCACTGGCAAGG - Intergenic
1063765956 10:9140712-9140734 TGGGCATTCCGCCAATCTCAAGG - Intergenic
1065233296 10:23621192-23621214 TGGCCATCCCTGCACAAACAAGG + Intergenic
1065636879 10:27743090-27743112 GGGGCAGACCTGCACTCCCAGGG + Intronic
1065830238 10:29608510-29608532 TGGGCATCCCTGCACTCTCCAGG + Intronic
1065976462 10:30846766-30846788 CAGGCATCTCTGCACTCTCAGGG + Intronic
1066188804 10:33036894-33036916 CAGGTATCCCTGCACTCTCGGGG + Intergenic
1066243223 10:33557896-33557918 TGGGCTTCCATGCTGTCTCATGG - Intergenic
1066508125 10:36066339-36066361 CAGGCATCCTTGCACTCTCAGGG + Intergenic
1066653370 10:37679843-37679865 TGGGCATCCCTGTCCTTTCCTGG + Intergenic
1067684491 10:48458415-48458437 TGGGCACACCTGCTCTCCCAAGG - Intronic
1067721529 10:48731414-48731436 TGGGCCATCCTGCACCCTCATGG + Exonic
1068222835 10:54064835-54064857 TAGGCATCTCTGTGCTCTCAGGG - Intronic
1069156158 10:65034101-65034123 TGGGCATCTTGGCACTCTTAGGG + Intergenic
1069249187 10:66246257-66246279 TAGACATCCCTGCACTCTTGGGG - Intronic
1070173788 10:73953417-73953439 TGGTCATCCCTGGACCCTCCTGG - Intergenic
1070201288 10:74208186-74208208 CAGGTATCCCTGCACTCTCTGGG - Intronic
1070428683 10:76315367-76315389 CTGGCATCCCTGTGCTCTCAGGG + Intronic
1071060984 10:81570744-81570766 CAGGCATCCCTGCACTCTCAGGG - Intergenic
1071336101 10:84601523-84601545 GGGGCTTCCTTGCACCCTCAAGG + Intergenic
1072753215 10:97999263-97999285 TAGGCATCCCTGCACTCTTGGGG + Intronic
1072914342 10:99527750-99527772 TGGGCGTCCCTGCAGCTTCAGGG + Intergenic
1073099009 10:100997491-100997513 TGGCCACCCTTGCACTCCCAGGG + Intronic
1073260843 10:102188971-102188993 CAGGCATCCCTGCACTCTTGGGG - Intergenic
1073844973 10:107544722-107544744 CAGGCATCCCTGTGCTCTCAGGG + Intergenic
1073859403 10:107720344-107720366 TGGTCCTCCCTGCCTTCTCAAGG - Intergenic
1074301921 10:112240800-112240822 TGAGCATCCCTGCGCTCTTGTGG - Intergenic
1076206009 10:128603746-128603768 TGGTCATCCATGAACTCTGATGG + Intergenic
1076655255 10:132019537-132019559 CAGGCATCCCTGCACTCTTGGGG - Intergenic
1076825180 10:132963594-132963616 GGGGCATCCCAGCCCTCACAGGG + Intergenic
1076904216 10:133354376-133354398 TGGGCTTGCCTGCACCCCCAAGG + Intergenic
1077704061 11:4467332-4467354 GGGGCCTCCCTACAGTCTCAAGG - Intergenic
1077938756 11:6817971-6817993 TGGGCATCCCTGCACTCTTGGGG + Intergenic
1078345635 11:10545163-10545185 TGGGCATCCTTGTGCTCTCAGGG - Intergenic
1078529368 11:12125062-12125084 TGGGGCTTCCTGCGCTCTCAGGG + Intronic
1080967094 11:37225201-37225223 CAGGGATCTCTGCACTCTCAGGG - Intergenic
1081044213 11:38251123-38251145 CGGGCATCCCTGCAGTCTTAGGG - Intergenic
1081164053 11:39786380-39786402 CAGGCATCCCTGCACTCTCGGGG - Intergenic
1081268489 11:41057090-41057112 CAGGCATCTCTGTACTCTCAGGG + Intronic
1081284106 11:41246449-41246471 GGGGCATCTCTGCACTCTCAGGG - Intronic
1081767483 11:45621629-45621651 TGGGCATCCTTGCACTCTTGGGG - Intergenic
1082974757 11:59060476-59060498 TGAGCATCCCTACTCTTTCACGG + Intergenic
1085334381 11:75679686-75679708 TCAGCATCCCCGCACTCTCAGGG - Intergenic
1085435070 11:76493030-76493052 TGGGCATCCGTGTGCTCTCAGGG + Intronic
1086249198 11:84794512-84794534 TGGGCATCCCTGTGCTCTTGGGG + Intronic
1086461842 11:87013770-87013792 TGGGGATCCCTGATATCTCAAGG + Intergenic
1086850036 11:91798515-91798537 CAGGCCTCCCTGTACTCTCAGGG + Intergenic
1086913906 11:92505470-92505492 TGTGCATCACTGCCCTCTCTGGG + Intronic
1087131301 11:94671626-94671648 TGGGCATCTCTGTGCTCTCAGGG + Intergenic
1087265495 11:96056182-96056204 AGGGCATCCCTGCCCCCACAGGG + Intronic
1087442989 11:98208685-98208707 TGGGCATCCCTGTGCTCTTGGGG - Intergenic
1088288092 11:108207735-108207757 CAGGCATCCCTGCACTCTCGGGG - Intronic
1088328921 11:108629568-108629590 CGGGCATCCCTGCTCTCTCAGGG - Intergenic
1088650963 11:111958055-111958077 TGGGCATCCCTGTGCTCTTGGGG + Intronic
1088651034 11:111958333-111958355 CAGGCATCGCTGCACTCTCAGGG + Intronic
1089302550 11:117507407-117507429 AGGGCACCCCTGCACTTTCAGGG + Intronic
1089404543 11:118186702-118186724 TGGGCACACCTACACTTTCACGG + Intergenic
1089683750 11:120133935-120133957 TGGGGGGCCCTGCACTGTCATGG - Intronic
1090277920 11:125432545-125432567 TGGGCATCCCCGCAGGCTCTTGG - Exonic
1091808471 12:3375092-3375114 TTGGCCTCCCTGGACTCTCTGGG + Intergenic
1093317296 12:17667061-17667083 CAGACATTCCTGCACTCTCAGGG - Intergenic
1093525821 12:20102540-20102562 CAGGCATCCCTGCATTCTTAGGG - Intergenic
1095042215 12:37455610-37455632 CAGGCATCCCTGCACTCTTGGGG + Intergenic
1095749785 12:45697353-45697375 TGGGCATCCCTGCACTCTCAGGG - Intergenic
1096245783 12:49984996-49985018 TGGGCCTCCCTGCTCTTTCTGGG + Intronic
1097450812 12:59734462-59734484 TGGACATCCCTGCACTCTCTGGG - Intronic
1097492077 12:60282869-60282891 TGGGCATCTCTGCATTTTCATGG - Intergenic
1097500175 12:60392087-60392109 CAGGCATCTCTGCCCTCTCAGGG + Intergenic
1097536222 12:60873341-60873363 CGGGCATCTCTGCATTCTCAGGG - Intergenic
1098290945 12:68956308-68956330 CTGGCATCCCTGCACTCTTGGGG - Intronic
1098519721 12:71421345-71421367 TGGTCATCTCTGAACTCTCAGGG - Intronic
1098803100 12:74986053-74986075 CAGGCATCTCTGCACTCTCAGGG - Intergenic
1098951497 12:76644962-76644984 CAGGCATCTCTGCACTCTCAGGG + Intergenic
1099295245 12:80821786-80821808 CAGGCATCTCTGCATTCTCAGGG + Intronic
1099376105 12:81897748-81897770 TGGAGATCCCTTCCCTCTCAAGG + Intergenic
1099738433 12:86600822-86600844 CCGGCATCCCTGTACTCTCGGGG + Intronic
1101858243 12:108462377-108462399 TGGACATCACTGTACTTTCATGG + Intergenic
1103173570 12:118843314-118843336 CGGGCATCCCTGTGCTCTCTGGG + Intergenic
1106709088 13:32311842-32311864 TGGGCCAGCCTGGACTCTCAGGG - Exonic
1106999662 13:35527735-35527757 TGGGCATCCCTATGTTCTCAGGG - Intronic
1107119539 13:36781468-36781490 TGGGCATCCAGGCTTTCTCATGG + Intergenic
1107228951 13:38085905-38085927 CAGGCATCCCTGTGCTCTCATGG + Intergenic
1107841035 13:44458617-44458639 TGGGCATCCCTGTGCTCTCGGGG + Intronic
1108559520 13:51628454-51628476 CGAGCATCCCTGGACTCTCAGGG - Intronic
1108786317 13:53906264-53906286 TGGAAACTCCTGCACTCTCATGG - Intergenic
1109396636 13:61766834-61766856 TGGGCATCCCTGTACTCCTGGGG - Intergenic
1109438831 13:62343144-62343166 CAGGCATCTCTGCACTCTCAGGG + Intergenic
1109478776 13:62919820-62919842 TGGACATCCCTGTGCTCTCAGGG - Intergenic
1109683622 13:65784518-65784540 TGAGCATCCCTGCACTCTCAGGG - Intergenic
1110308997 13:74024519-74024541 TGTGCATGCCTGCCCTCTCTCGG - Intronic
1110730892 13:78877318-78877340 TGAGCATTCCTGCACTCTCAGGG - Intergenic
1110777896 13:79432086-79432108 TGGGCATCTCTGCACTCTCGGGG + Intergenic
1111119154 13:83823608-83823630 TGGGCATCCCTCCACTCTCGGGG + Intergenic
1111253676 13:85639110-85639132 CAGGCATCTCTGCACTCTCGGGG - Intergenic
1111354537 13:87080580-87080602 TGGGCATCCCTGCGCTCTCAGGG - Intergenic
1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG + Intergenic
1112086013 13:96033557-96033579 AACGCATCCCTGCACTCTCAGGG + Intronic
1112978954 13:105357454-105357476 TGGTCATCCATGATCTCTCAAGG + Intergenic
1112991096 13:105514791-105514813 TGTGCATCCCTGGACTTACAGGG - Intergenic
1113229220 13:108194626-108194648 CAGGGATCCCTGCACTCTCATGG + Intergenic
1114397953 14:22383962-22383984 TGGGAATCCCCATACTCTCAGGG - Intergenic
1114665907 14:24376970-24376992 CGGGCATCCCTGGTCTCTCAGGG + Exonic
1116019201 14:39441054-39441076 TGGGCATCCCTGTGCTCTCTGGG + Intergenic
1116151351 14:41145711-41145733 TGGGCATCCCTGTGTTCTCAGGG - Intergenic
1116221772 14:42096495-42096517 TGGGCATTTCTACATTCTCAGGG - Intergenic
1116317075 14:43410731-43410753 TGGGCATCCCTGTACTCTCAGGG - Intergenic
1116448634 14:45039747-45039769 TGGGCATTCCTGTGTTCTCAGGG - Intronic
1116961549 14:50973052-50973074 TGGGCATCCCTGCGCTCTTGGGG + Intergenic
1117042247 14:51778008-51778030 TGGTCTTCCCTCCAGTCTCAGGG + Intergenic
1117930780 14:60838737-60838759 TGGGCATCCCTGCACTCTCGGGG + Intronic
1118058328 14:62106694-62106716 TGGGGATGCCTGCAGGCTCAGGG + Exonic
1118242427 14:64073003-64073025 GGGGCTTCCCTGCTCTCTCTAGG + Intronic
1118473205 14:66094077-66094099 CAGGCATCTCTGCACTCTCGGGG - Intergenic
1118522243 14:66597606-66597628 CAGGCATTTCTGCACTCTCAAGG - Intronic
1118815879 14:69313515-69313537 TGGGCCTCCCTCCACTTTCTTGG + Intronic
1119257275 14:73209117-73209139 TGGGCATCCCTGTGCTCTCAGGG - Intronic
1119666199 14:76486780-76486802 GGGACACCCCTGCACTCCCAGGG + Intronic
1120589950 14:86363619-86363641 TGGGCATCCCTGTGCTCTTGGGG + Intergenic
1120589972 14:86363710-86363732 CTGGCATCACTGCACTCTCAGGG + Intergenic
1121967316 14:98322509-98322531 TGGTCATCCCTTCTCTCTGAAGG + Intergenic
1202848696 14_GL000225v1_random:2051-2073 TGGGCATCCCTGGGATCCCAGGG + Intergenic
1202928637 14_KI270725v1_random:18342-18364 TGGGCATTCCTCTACTCTGATGG + Intergenic
1202940738 14_KI270725v1_random:143335-143357 CAGGCATCCCTGCACTCTTGGGG + Intergenic
1124820753 15:33043929-33043951 TGGGCATCTCTGCACTCTCAGGG + Intronic
1125381687 15:39092830-39092852 CAGGCATCTCTGCACTCTTAGGG - Intergenic
1126093606 15:45072448-45072470 TGGGCATCCCGGCTCACCCACGG - Intronic
1126201765 15:45994748-45994770 TGGGCATCGATGCAATCTCAAGG - Intergenic
1126292726 15:47099912-47099934 CAGGCATCCCTGCACTCTTGGGG - Intergenic
1126979725 15:54227709-54227731 TGGGCATCCCTGAGCTCTTGGGG - Intronic
1127553138 15:60060769-60060791 TGGGGAGCACTGGACTCTCAGGG + Intronic
1127722819 15:61719521-61719543 TCAGCATCCCAGCACACTCAAGG + Intergenic
1129738945 15:77980542-77980564 TGGGCCTCCCTCCACTGTAATGG - Intergenic
1131943027 15:97587837-97587859 TGGGCCAACCTACACTCTCATGG + Intergenic
1132305251 15:100807432-100807454 CAGGCATCCCTGCACTCTTGGGG + Intergenic
1132908935 16:2298654-2298676 TGGGGTTCCGTGCCCTCTCATGG - Intronic
1132971805 16:2692894-2692916 CAGGCATCCCTGCACTCTTGGGG - Intronic
1132978920 16:2724952-2724974 GGGGCATCCCTGTGCTCTCGGGG + Intergenic
1133184504 16:4085879-4085901 TGGTCATCCCTGGACACGCATGG - Intronic
1133230925 16:4366171-4366193 TGGGCTTCCCTGCACACCCCAGG + Intronic
1134098242 16:11433815-11433837 TGGGCTTCCCCGCCCTCTCTGGG - Intronic
1134254481 16:12600376-12600398 CGGGCATCCCTGTGCTCTCAGGG + Intergenic
1134569700 16:15280722-15280744 TGGGAATCCCTGGGCTCTCTGGG - Intergenic
1134685996 16:16159221-16159243 TGTGGTTCCCTGCACTCCCATGG + Intronic
1134732679 16:16475327-16475349 TGGGAATCCCTGGGCTCTCTGGG + Intergenic
1134934761 16:18236641-18236663 TGGGAATCCCTGGGCTCTCTGGG - Intergenic
1136716293 16:32286424-32286446 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1136834679 16:33492702-33492724 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1137692814 16:50441245-50441267 TGGTCATATCTGCACTCTCAGGG + Intergenic
1138878247 16:60979252-60979274 CAGGCATCCCTGCACTCTTGGGG + Intergenic
1138998149 16:62477781-62477803 CAGGCATCCCTGTGCTCTCAGGG + Intergenic
1139015402 16:62683947-62683969 TGGGTATCCCTGCACTTTCATGG + Intergenic
1139150874 16:64380992-64381014 TGGGCATCCCTGCACTCTTGGGG + Intergenic
1139183030 16:64770295-64770317 CAGGCATCTCTGCACTCTCAGGG + Intergenic
1139390079 16:66601803-66601825 CAGGCATCCCTGTACTCTTAGGG - Intergenic
1139463730 16:67142696-67142718 CTGGCATCCCTGCACTCTCAGGG - Intronic
1139660658 16:68418694-68418716 TGGGCATCCCTGTTCTCATATGG - Intronic
1141429890 16:83966036-83966058 TGGTCATCTCTGTCCTCTCAGGG - Exonic
1203010124 16_KI270728v1_random:231330-231352 GGGGCATCCCTGCCCTCCCAGGG - Intergenic
1203099263 16_KI270728v1_random:1291388-1291410 CAGGCATCCCTGCACTCTTGGGG + Intergenic
1203144848 16_KI270728v1_random:1792990-1793012 GGGGCATCCCTGCCCTCCCAGGG + Intergenic
1142940779 17:3378476-3378498 CAAGCATCCCTGCACTCTTAGGG - Intergenic
1143852930 17:9826140-9826162 TGGGCATCCCTGCCCCCTGGGGG + Exonic
1143966763 17:10761122-10761144 TGGGGACCCCGGCACTCACACGG + Intergenic
1144714412 17:17424177-17424199 CAGGCATCCCTGCACTCTTAGGG + Intergenic
1146419645 17:32671191-32671213 TGGGCATCACTGCATTCCCCTGG + Intronic
1146729235 17:35180181-35180203 TGGGCTTTTCTGCTCTCTCATGG + Intronic
1148757939 17:49984361-49984383 TGTGCTTCCCTGCACACTGAGGG - Intergenic
1149330658 17:55577769-55577791 CGGGCATCTCTGCACTGTCGGGG - Intergenic
1150743376 17:67797376-67797398 AGGGCATCCCTTCACTCACCTGG + Intergenic
1151395423 17:73819771-73819793 CAGGCATCCCTGCACTCTTGGGG - Intergenic
1151459074 17:74244014-74244036 TGGGCATCCCTGGCCGCTGATGG + Exonic
1153472987 18:5467930-5467952 TGGGCATCCCTGCACTCTCAGGG + Intronic
1153723886 18:7936302-7936324 TGGGCATCTTTGCACTCTCAGGG + Intronic
1154042177 18:10866670-10866692 TGGGCATCCATGCTCTCACCTGG + Intronic
1154357631 18:13633768-13633790 AGGGCATCCCTGTGCTCTCAGGG - Intronic
1155215657 18:23641297-23641319 TGGGCATCCCTGTGCTCTCTGGG + Intronic
1157728676 18:49985295-49985317 TGGGCACACCTGAACTCTCTGGG + Intronic
1158774028 18:60555312-60555334 TGGGCATACCTGCACTCTTGGGG + Intergenic
1158867790 18:61654640-61654662 TGGGCAGGGCTGGACTCTCAAGG - Intergenic
1159623772 18:70669179-70669201 CAGGCATCTTTGCACTCTCAGGG + Intergenic
1159696301 18:71560830-71560852 TGGGCATCCTTGCCCTTTCCTGG - Intergenic
1159704970 18:71675101-71675123 TGGGAATCCCTGCATTCTCAAGG - Intergenic
1159767001 18:72502909-72502931 CAGGCATCCCTGCACTCTTGGGG - Intergenic
1161246650 19:3256284-3256306 TGCTCATCCCTGACCTCTCAGGG + Intronic
1161554028 19:4930433-4930455 TGGGCAGCTCTGGTCTCTCAGGG + Intronic
1161781709 19:6297490-6297512 CAGGCATCCCTGCACTCTTGGGG + Intergenic
1162574367 19:11490283-11490305 TGGGCTTCCATGCCCTCTCCGGG + Intronic
1162671490 19:12261207-12261229 TGGGCATCCTTCCTCTGTCATGG - Intronic
1163593167 19:18205381-18205403 TGGGCGTCCCAGTACTCCCAGGG - Intergenic
1164881097 19:31733654-31733676 TGGGCATCCCTGAAGCCCCAGGG + Intergenic
1164884819 19:31769664-31769686 TGGGCTGCCCTGCACTGCCAAGG + Intergenic
1164984350 19:32637709-32637731 CAGGAATCTCTGCACTCTCAGGG + Intronic
1165248827 19:34513864-34513886 AGGGCTTCCCTGCACCCCCATGG + Intergenic
1165259088 19:34597686-34597708 AGGCCTTCCCTGCACCCTCATGG + Intronic
1165906816 19:39199295-39199317 TGGGCAGCCCTGCGCGATCACGG - Intronic
1166897378 19:46032497-46032519 CAGGCATCTCTGCACTCTTAGGG + Intergenic
1167707925 19:51092789-51092811 TGAAAATCCCTGCACTGTCAGGG - Intergenic
1168287071 19:55340353-55340375 GGGACCTCCCTGCACTCCCAGGG + Intronic
1168474945 19:56668872-56668894 TGGGTACCCCTGCACACTCCGGG - Intronic
1168630315 19:57950889-57950911 AGGGCATCCCTGCACTCTTGGGG - Intergenic
925515209 2:4674328-4674350 TGGGCATCTCTGCACTCTCGGGG + Intergenic
926171489 2:10555693-10555715 TGTGCATTCCTGCACTCTCGGGG + Intergenic
926547108 2:14255521-14255543 CGGGCATCCCTGTGCTCTCGGGG - Intergenic
926554455 2:14341347-14341369 TGGGCATCCCTGTGCTCTTGGGG + Intergenic
926859385 2:17292222-17292244 CAGGCATCCCTGCACTCTTAGGG - Intergenic
926984834 2:18611412-18611434 TGGGCCTCCCTGCTCTCTTTTGG - Intergenic
927236567 2:20880463-20880485 TGGGCATCCCTGAGCTCTGGGGG - Intergenic
927743302 2:25591218-25591240 CAGGCATCTCTGCACTGTCAGGG - Intronic
928178913 2:29053894-29053916 TGGGCCTCCACCCACTCTCAGGG + Exonic
928182795 2:29081160-29081182 CGGGCATCCCTGTACTCTCAGGG - Intergenic
928427854 2:31193381-31193403 TGGGCATCCCAGCCCTCTCATGG + Intronic
928470370 2:31569024-31569046 CGGGCTTCCCTGTGCTCTCAGGG - Intronic
928637790 2:33266052-33266074 TAGACATCCCTGCACTCTAAGGG + Intronic
928797095 2:35035068-35035090 TGGCCATCCCTGCACTCTTTGGG - Intergenic
929757431 2:44779075-44779097 TGGGCCTCCCGGAGCTCTCAAGG - Intergenic
929847247 2:45542366-45542388 TGGGCATCCCTGCACTCTCAGGG - Intronic
930611909 2:53553818-53553840 CAGGCATCTCTGCACTCTCAGGG + Intronic
930957167 2:57217073-57217095 TGGGCATCTCTGCACTCTTGGGG + Intergenic
931300372 2:60973327-60973349 TAAGCATCTCTGCACTTTCAGGG + Intronic
931665593 2:64608060-64608082 TGGGAATCCCCTCACTCTCTGGG - Intergenic
932398361 2:71463376-71463398 CAGGCATCCCTGCACTCTCTGGG - Intronic
933606615 2:84390204-84390226 TGGGCATCCCTGCACTCTTGGGG - Intergenic
933801286 2:85961968-85961990 TGGGCATCCCTGTACTCTTGGGG - Intergenic
934696628 2:96404930-96404952 TGGGCATCTCTGCACTCTTGGGG - Intergenic
934699773 2:96430223-96430245 TAGGCATCCCTGCACTCTTGGGG + Intergenic
935199486 2:100844026-100844048 TGGGCAGCCCGGCCCTATCAGGG - Intronic
936463481 2:112727706-112727728 TGGGCAACCCTGGCCTCTCTGGG - Intronic
936469832 2:112789280-112789302 TGGCCATCCCTTGACTCTCTGGG - Intergenic
936563657 2:113564725-113564747 TAGGCATCCCTGCTCTCTTTTGG - Intergenic
937122917 2:119453082-119453104 TGGCCATGCCTGCACTGTCCTGG - Intronic
937167693 2:119836648-119836670 TGGGCATCCCTGTGCTCTCGCGG + Intronic
937370929 2:121296678-121296700 GGGGCATCCCTGTACTCTCAGGG - Intergenic
938096525 2:128467539-128467561 CAGGCATCTTTGCACTCTCAGGG - Intergenic
938180774 2:129179714-129179736 CGGGCATCCCTGCATTCTTGAGG - Intergenic
938722168 2:134076601-134076623 TGGGCATCTCTGCATTCTTGGGG - Intergenic
938732662 2:134158569-134158591 CGGGCATCCCTGCATTCTTGGGG - Intronic
939017741 2:136920994-136921016 CTGGCATCCCTGGGCTCTCAGGG - Intronic
939801775 2:146720287-146720309 TGGGCATCCCTGTGCTCTCAGGG + Intergenic
940422922 2:153499856-153499878 CAGGCATCCCTGCACTCTCAGGG - Intergenic
940423879 2:153509220-153509242 GAGGCAGCCCTGCACTCTCAGGG - Intergenic
940582715 2:155601404-155601426 TGGGCATCCCTGTCCTCTCAGGG - Intergenic
940653609 2:156461794-156461816 TGGGAATTCCTCTACTCTCATGG - Intronic
940694379 2:156959900-156959922 AAGGCATCTCTGAACTCTCAGGG - Intergenic
940711288 2:157165683-157165705 TGGGCATCCCTGCAATTTCAGGG - Intergenic
940957044 2:159739136-159739158 TGGGTATCCCTGTGCTCTCAGGG - Intronic
941130956 2:161650557-161650579 TGGGCATCCCGGCACTCTCGGGG + Intronic
941151317 2:161918953-161918975 CAGGCATCCCTGTGCTCTCAGGG + Intronic
942053584 2:172162817-172162839 CAGGCATCTGTGCACTCTCAGGG - Intergenic
943179535 2:184525058-184525080 TGGGCATCTCTGCACTCAGAAGG - Intergenic
943190913 2:184679509-184679531 TGGACATCTCTGCACTCCCGGGG + Intronic
943191767 2:184686167-184686189 CAGGCATCCCTGCACTCTTGGGG - Intronic
943223882 2:185144502-185144524 CAGGCATCCCTGAACTCTCAGGG + Intergenic
943396272 2:187338876-187338898 CTGGCATCCCTACACTCTCAGGG - Intergenic
943427089 2:187750358-187750380 TAGGCATCTCTGCACTCTCGGGG - Intergenic
943928570 2:193820060-193820082 TGGGTATCTCTGCATTTTCAGGG - Intergenic
944146662 2:196514095-196514117 CAGGCTTCCCTGCACTCTCAGGG + Intronic
944483769 2:200182287-200182309 CAGGCATCCCTGCACTCTTGGGG + Intergenic
945395228 2:209307793-209307815 AGGGCAGCCCTGTGCTCTCAGGG - Intergenic
945721200 2:213421133-213421155 TGGGCATCCATATACTCTCGGGG + Intronic
946487377 2:220113945-220113967 TGGGCATGGCAGCACACTCAGGG - Intergenic
947054894 2:226088451-226088473 CCAGCATCCTTGCACTCTCAGGG - Intergenic
947327369 2:228992881-228992903 TGGGCACCTCTGCACTCTGGGGG - Intronic
948161995 2:235832762-235832784 TGAACATCCCTTCACTCCCAAGG - Intronic
948258099 2:236583221-236583243 TGGGCAGCCCTGCAGTCCCCAGG + Intergenic
948312459 2:236998952-236998974 TTGTCATCCCTGCACTTGCAGGG - Intergenic
948476171 2:238221295-238221317 CAGGCATCCCTGCACTCTTGGGG - Intergenic
948575517 2:238947132-238947154 TAGGCATCCCTGCACTCTTGGGG - Intergenic
948712899 2:239836315-239836337 CAGGCATCTCTGCACTCTCAGGG + Intergenic
1169309249 20:4521375-4521397 TGGGCATCCCTCCACTCTCAGGG + Intergenic
1169880402 20:10341231-10341253 TGGGCATCCCTGTGCTCTGGAGG + Intergenic
1171285914 20:23938010-23938032 TGGGCATCCCTGTGCTCTCAGGG + Intergenic
1171391310 20:24803255-24803277 TGGACATCCCAGCATTCCCATGG - Intergenic
1173090421 20:39965352-39965374 TGGGCATTCCTTCAGTCTCTGGG + Intergenic
1174138756 20:48398446-48398468 CGGGCATCCCTGCACTCTTGGGG - Intergenic
1174147502 20:48462386-48462408 TGGGCACCCCTCCACTCTTTGGG + Intergenic
1175984263 20:62756090-62756112 GGGGCATCCCTGCACTCTGGGGG + Intronic
1176166939 20:63679336-63679358 TCGGCCACCCTGCACCCTCAGGG + Intronic
1176590659 21:8646925-8646947 TGGGCATTCCTCTACTCTGATGG + Intergenic
1177262413 21:18748472-18748494 TGGGTATCTCTGTACTCTCAGGG - Intergenic
1177357906 21:20032059-20032081 CAGGCATCTCTGCACTCTCAGGG - Intergenic
1178937323 21:36874848-36874870 CAGGCATCCCTGCACTCTCGGGG + Intronic
1178947279 21:36959111-36959133 TGGGCATCCCTGCACTCTCAGGG + Intronic
1180025777 21:45161298-45161320 CAGGCATCCCTGCACTCACCAGG + Intronic
1180273488 22:10623959-10623981 TGGGCATTCCTCTACTCTGATGG + Intergenic
1181761177 22:25059794-25059816 AGGGGACCCCTGCACTCTCAGGG + Intronic
1182394944 22:30028516-30028538 TGGGCATCCCTCCCATCACATGG + Intronic
1183316730 22:37141204-37141226 CAGGTGTCCCTGCACTCTCAGGG + Intronic
1183316762 22:37141333-37141355 CAGGCATCCCTGCACTCTCAGGG + Intronic
1183333884 22:37235823-37235845 GGGTCATCCCTGGAATCTCAGGG + Intronic
1184054511 22:42035380-42035402 CAGGCATCCCTGTGCTCTCAGGG - Intronic
1184331304 22:43829589-43829611 GGGGCCTCCCTGCGCTCCCAAGG - Intronic
1184869546 22:47226456-47226478 CAGGCATCCCTGTGCTCTCAGGG - Intergenic
1184918856 22:47591466-47591488 GGGCCATCCCTGCAGGCTCAGGG + Intergenic
1185182566 22:49371825-49371847 TGGGCATCCCAGCGCCCCCAAGG - Intergenic
949331621 3:2929941-2929963 TGGGGATCCCTGCCCTGGCATGG - Intronic
950469764 3:13177385-13177407 TGGGCAGTTGTGCACTCTCAGGG - Intergenic
950535980 3:13578420-13578442 TGGATATCCCTGGACTCTCTGGG + Intronic
951508993 3:23480387-23480409 AAGGCATCCCTGCACTCTTGGGG - Intronic
951718565 3:25674292-25674314 GAGGCATCCCTGTACTCTCAGGG - Intergenic
952793242 3:37217206-37217228 CAGGCATCTCTGCACTCTCTGGG + Intergenic
952959181 3:38579165-38579187 TGGGCATCCCTGTCCTGACAGGG - Intronic
953748287 3:45591570-45591592 TGGGCATCCCTGTGCTCCCGGGG - Intronic
954647488 3:52140482-52140504 TGGGCTTCCCAGCACCATCAAGG + Intronic
954882789 3:53846764-53846786 GGGGCATGCCTGCACCCTCAGGG + Intronic
955111991 3:55958858-55958880 CATGCATCCCTGCGCTCTCAGGG - Intronic
955303717 3:57809218-57809240 CAGGCATCCCTGCACTCTTGGGG + Intronic
956462422 3:69485328-69485350 CAGGCATCCCTGCACTCTTAGGG - Intronic
957156394 3:76550622-76550644 CAGGCATCCCTGCACTCTCAGGG + Intronic
957459480 3:80497832-80497854 TGAGCATCCCTTCACTGTCAGGG - Intergenic
957636254 3:82790317-82790339 TGGGCATCTCTGCACTCTCAGGG + Intergenic
957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG + Intergenic
957730150 3:84124755-84124777 CAGGCATCTCTGCACTCTCTGGG + Intergenic
957730236 3:84125347-84125369 CAGGCATCTCTGCACTCTCGGGG + Intergenic
958418630 3:93906701-93906723 TGGGCATCTCTGTACTCTTGAGG + Intronic
958678340 3:97294109-97294131 TGGGCATCCCTGTGCTCTTGGGG - Intronic
958977402 3:100682875-100682897 GAGGCATCTTTGCACTCTCAGGG + Intronic
959389827 3:105759766-105759788 TGGGCATCCCTATACTCTTGGGG - Intronic
959476665 3:106820989-106821011 TGGGCATCCCTGTGCTCTCGGGG + Intergenic
961311289 3:126003754-126003776 CAGGCATCCCTGTGCTCTCAGGG + Intergenic
961628429 3:128279502-128279524 TGGGCCTGCCTGGACTCTGATGG + Intronic
962212049 3:133487328-133487350 TAGGCATTCCTGCACTCTCGGGG - Intergenic
962763929 3:138543516-138543538 TGGGCATCCCTGCGCTCTTATGG - Intronic
963250088 3:143095342-143095364 CAGGCATCCCTGTGCTCTCAGGG + Intergenic
963424620 3:145110855-145110877 TGGTCATCCCAGAACTCTGATGG - Intergenic
963805038 3:149714330-149714352 CAGGCATCTCTGAACTCTCAGGG + Intronic
964255105 3:154766764-154766786 TGGCTATCTCTGCACTCACAGGG - Intergenic
964927366 3:161975368-161975390 TGGGCATCCCTGCACTTTCAGGG - Intergenic
964927932 3:161979399-161979421 TGGGCATCTCTGTGATCTCAGGG - Intergenic
964996704 3:162891446-162891468 AGGGCATCCCTGCACTCATGGGG + Intergenic
965051485 3:163655191-163655213 CAAGCATCCCTGCACTCTCGGGG - Intergenic
965061426 3:163789033-163789055 TAGGCATCCCTGTTCTCTCGGGG - Intergenic
965074063 3:163953825-163953847 CAGGCATCTCTGCACTTTCAGGG - Intergenic
965367668 3:167820389-167820411 TGGGCATCTCTGCACTCTCCAGG + Intronic
965924392 3:173959067-173959089 CAGGCATCTCTGCACTCTCGAGG - Intronic
966254085 3:177898486-177898508 TAGGCATACCTGTGCTCTCAGGG + Intergenic
967444934 3:189555264-189555286 CAGGCATCCCTGCACTCTTTGGG - Intergenic
968530935 4:1091257-1091279 TGGGCCTGTCTGCACTCCCAGGG + Intronic
969179134 4:5423974-5423996 TGGGCATCCCTGTGCTCTCAGGG + Intronic
970063829 4:12068264-12068286 TGGGCATCCTTGCTTTCTCCTGG + Intergenic
971092334 4:23360466-23360488 GGGGCATCCCTGTGCTCTCGGGG + Intergenic
971834740 4:31748478-31748500 CTGGCATCCCTGAGCTCTCAGGG - Intergenic
972106366 4:35494039-35494061 TGGACATCCCTGTGCTCTCTGGG + Intergenic
972128461 4:35800808-35800830 CAGGCATCCCTGTGCTCTCAGGG + Intergenic
972358398 4:38303776-38303798 CAGGCATCCCTGTGCTCTCATGG - Intergenic
973027022 4:45284827-45284849 TGGGCATCCCTGCACTTATGGGG - Intergenic
973534622 4:51868187-51868209 CAGGCATCCCTGCACTCTCAAGG - Intronic
974260379 4:59518363-59518385 CAAGCATCTCTGCACTCTCAGGG - Intergenic
974644275 4:64671971-64671993 TGGGCATCTGTGCACTCTAGGGG - Intergenic
976097908 4:81528478-81528500 CAGGCATCTCTGCACTCTCAAGG - Intronic
976647234 4:87399432-87399454 TGGGCATCCCTGTGCTCTTGGGG + Intergenic
976647254 4:87399511-87399533 CGGGCATCTCTGCACTCTCAGGG + Intergenic
976729001 4:88244147-88244169 CAGGCATGCCTGTACTCTCAGGG + Intergenic
976734565 4:88296752-88296774 CAGGCATCCCTGCACTCTTGGGG - Intergenic
976734610 4:88296923-88296945 TGGGCATCCCTGTGCTCTTAGGG - Intergenic
976921550 4:90449802-90449824 CTGGCATCCATGCACTCTCTGGG - Intronic
977358987 4:95980661-95980683 TGGGTCTCTCTGCACTCTTAGGG + Intergenic
977816341 4:101417318-101417340 TGGGCATCTCGGCATTCTCGTGG - Intronic
978149457 4:105415567-105415589 TGGGCATCCCTGCACTCTCGGGG - Intronic
978248668 4:106604725-106604747 TGGGCATCTCTGCACTCTTGAGG - Intergenic
979687962 4:123531529-123531551 TGGGCTTCCCTGCATTTTGATGG - Intergenic
980450049 4:132958842-132958864 TAGGCATCTCTGCACTCTCAGGG + Intergenic
980480830 4:133385286-133385308 CGGGCATCCCTGCACTCTCAGGG + Intergenic
980574458 4:134666787-134666809 TGGGCATCTCTGCACTCTTGGGG - Intergenic
980731030 4:136824284-136824306 CAGGCATCTCTGCACTCTCAGGG - Intergenic
980744883 4:137000727-137000749 TGGGCATCTCTGCACTCTCAAGG + Intergenic
982610958 4:157574430-157574452 TGGGCATCTCTGCATTCTTGGGG + Intergenic
982802698 4:159723479-159723501 CCAGCATCCCTGCACACTCAAGG - Intergenic
983105093 4:163676708-163676730 TTGGCATCACTGCACTCCCTAGG + Intronic
983885516 4:172975929-172975951 TGTGCATCCCTGCACTCTTAGGG - Intronic
984325092 4:178241623-178241645 CAGGCATCCCTGCACTCTCAGGG + Intergenic
986622548 5:9691005-9691027 TGGGCGTCTCTGCACTGTCATGG + Intronic
987088748 5:14492265-14492287 TGGTCTTCCTTGCACCCTCACGG - Intronic
987537622 5:19208636-19208658 TGGGCATCCCTGCCCTCTTGGGG + Intergenic
987999492 5:25330708-25330730 CAGGCATCTCTGTACTCTCAGGG + Intergenic
988109947 5:26807465-26807487 TAGGCATACCTGCCCTCTCAGGG + Intergenic
988218540 5:28310989-28311011 TGGGCATCCCTGCATTCTCAGGG + Intergenic
988940309 5:36139100-36139122 CAGGCATCCCTGCACTTTCGGGG + Intronic
989537522 5:42581845-42581867 TGGGCATCCCCGTGCTCTCGGGG + Intronic
989730555 5:44642273-44642295 TGGGCATCCCTGCACTCTCAGGG - Intergenic
989821589 5:45800143-45800165 TGGGCATCCCTGTTCTCTCAGGG + Intergenic
990399946 5:55428213-55428235 GGGGCATCCCAGAATTCTCACGG - Intronic
991039762 5:62162992-62163014 CGGGCATCCCTGTGCTTTCAGGG - Intergenic
991107727 5:62862480-62862502 TGGGCATCCCTGTGCTCTTGAGG - Intergenic
991359385 5:65803530-65803552 CAGGCATCTCTGTACTCTCAGGG - Intronic
991359409 5:65803620-65803642 TGGGCATCCCTGTACTCTTAGGG - Intronic
992693225 5:79259838-79259860 CAGGCATCTCTGCACTCTCCGGG - Intronic
992839015 5:80668701-80668723 CGGGCATCTCTGCAATCTCAAGG - Intronic
992839041 5:80668798-80668820 TGGGCATCCCTGTGCTCTTGGGG - Intronic
993211941 5:84962420-84962442 TGGGCCTCCCTGCACTCTCAGGG - Intergenic
993703445 5:91144096-91144118 TGGGCATCTCTGCACTCTCAAGG - Intronic
994107380 5:95961962-95961984 TCGGCCGCCCTCCACTCTCACGG + Exonic
994517881 5:100793865-100793887 CGGGCATCCCTGCACTTTTGGGG + Intergenic
994753322 5:103764755-103764777 CAAGCATCCCTGCCCTCTCAGGG - Intergenic
995862914 5:116660884-116660906 TGGGCATTTCTGCACTCTTGGGG + Intergenic
996176661 5:120368167-120368189 TGGGCATCCCTGTGCTCTCTGGG + Intergenic
996234518 5:121108968-121108990 CAGGCATCCCTGCACTCTTGAGG - Intergenic
996537674 5:124595116-124595138 TGGGCACCCCTTCACTCACGTGG + Intergenic
996923915 5:128800328-128800350 CAGGCATCCCTGCACTCTTGTGG - Intronic
998480621 5:142459674-142459696 TGGGCATCTCTGCACTTTTGGGG - Intergenic
1003137023 6:3441590-3441612 TGGGCTTCCCTGCCCACTGACGG + Intronic
1003631974 6:7795443-7795465 TGGGGATCCCTGAACTAACAGGG - Intronic
1004161274 6:13215291-13215313 TCTCCCTCCCTGCACTCTCATGG - Intronic
1004304343 6:14487072-14487094 CGGGCATCCCTGTGCTCTCAAGG + Intergenic
1005594630 6:27367853-27367875 TGGGCATCCCTGTGCTCTTGCGG + Intergenic
1005781837 6:29201161-29201183 CGGGCATCTCTGCACTCTTGGGG + Intergenic
1007214696 6:40228064-40228086 CGGGCATCCCTGTGCTCTCGGGG + Intergenic
1007702827 6:43774415-43774437 TGGGGTTCCCTGTCCTCTCAGGG + Intronic
1008351840 6:50500183-50500205 TTGGTATCCCTGCCCTCACATGG + Intergenic
1009241795 6:61193857-61193879 CAGGCATCTCTGCACTCTCGGGG - Intergenic
1009684187 6:66935759-66935781 TGGGCATCCCTGTGCTCTTGGGG + Intergenic
1010519614 6:76817568-76817590 TAGGCATCTCTGCATTCTCGGGG + Intergenic
1010534483 6:77011114-77011136 CGGGCATCCCTGTGCTCTCCAGG + Intergenic
1010559567 6:77333198-77333220 CAGGCATTCCTGCACTCTCGGGG + Intergenic
1011822711 6:91271890-91271912 TGGGCATCCCTACACTTTCAGGG - Intergenic
1012122288 6:95384043-95384065 TGGGCATCTCTACACTCTCAGGG + Intergenic
1012133055 6:95519979-95520001 TGGGCATCCCCGCACTCTCGGGG - Intergenic
1014227251 6:118862190-118862212 TAGGCATCCCTGCACTCTTGGGG - Intronic
1014384618 6:120785719-120785741 CTGGCATCCCTGCACTTTCAGGG + Intergenic
1014391576 6:120872009-120872031 TGAGCATTCCTGCACTCTCAGGG + Intergenic
1014505424 6:122248430-122248452 TGGGCATCCCTGTGCTCTTGGGG - Intergenic
1014969086 6:127791974-127791996 CAGGCATCACTGCACTCTCAGGG - Intronic
1016076858 6:139805561-139805583 TGGGCATTCCTGTACTCTTGAGG - Intergenic
1016758952 6:147716416-147716438 CAGGCATCTCTGCACTCTCAGGG - Intronic
1016758973 6:147716506-147716528 TGGGCATCCCTGTGCTCTTGGGG - Intronic
1017522447 6:155213978-155214000 CAGACATCTCTGCACTCTCAGGG - Intronic
1017587854 6:155946969-155946991 TGGACATTCCTGCACTCTCAGGG + Intergenic
1018802515 6:167235431-167235453 CTGGCATCCCTGCACTCTTGGGG - Intergenic
1020586668 7:10078615-10078637 TAGGCATCTCTGCACTCTTGGGG + Intergenic
1021343219 7:19489527-19489549 TGGACATTCCTGCACTCTCAAGG - Intergenic
1021677566 7:23097010-23097032 TGGGCATCCCTGTGCTCTCAGGG + Intergenic
1024024463 7:45399315-45399337 TGGGCATCCCTGTACTCTTGGGG + Intergenic
1024225861 7:47326537-47326559 TGGGGCTTCCTGCACTCTAAGGG - Intronic
1024786303 7:52911457-52911479 CAGCCATCTCTGCACTCTCAGGG - Intergenic
1025288120 7:57685390-57685412 CAGGCATCCCTGCACTCTTGAGG + Intergenic
1027682089 7:81233627-81233649 CGGGCATCCCTGTGCTCTCAGGG - Intergenic
1027924745 7:84446966-84446988 CAGGCATCCCCGCACTCTCAAGG + Intronic
1028111677 7:86949582-86949604 AGGGCATCTTGGCACTCTCAGGG + Intronic
1028136666 7:87230200-87230222 TGGGCATCTCTGAACTCTTGGGG + Intergenic
1028402037 7:90434296-90434318 TAGGCATCCCTGCATTCCCAGGG - Intronic
1028527503 7:91801766-91801788 TGGGCATCTCTGCACTCTCGGGG - Intronic
1028596020 7:92547000-92547022 CAGGCATCTCTGCACTCTTAGGG + Intergenic
1029105364 7:98170839-98170861 TGGGGAGCCCTGCAGTGTCATGG + Intronic
1029327552 7:99823146-99823168 CAGGCATCCCTGCACTCTTGGGG + Intergenic
1030514156 7:110519830-110519852 CAGGCATCCCTGCACTCTTGGGG - Intergenic
1030721850 7:112881030-112881052 CGGGCATCCCTGCGCTCTTGGGG + Intronic
1030981205 7:116186738-116186760 TGGGCATCCCTGTGCTCTTGGGG - Intergenic
1031248571 7:119350363-119350385 CGGGCATCCCTGCACTCTTAGGG + Intergenic
1031265205 7:119572501-119572523 TAGGAATCCCTGCACTCTTGGGG + Intergenic
1031859005 7:126957458-126957480 TGGGCATCCCTGCTCTCTCAGGG + Intronic
1031922070 7:127609384-127609406 CAGGCATCCCTGCACTCTCAGGG - Intergenic
1032658417 7:133955963-133955985 TGGGCATCTCTGGACTCTCAGGG - Intronic
1032873797 7:136015381-136015403 TTGACATGCCTGCACTCTTAAGG + Intergenic
1033549496 7:142433867-142433889 GGGACATCCCTGTCCTCTCATGG - Intergenic
1034101902 7:148457637-148457659 CCGGCATCCCTGCACTCTTGGGG - Intergenic
1034210500 7:149358583-149358605 TAGGCATCTCTGCACTCTCAGGG - Intergenic
1034210520 7:149358674-149358696 TGGGCATCCCTAAGCTCTCGGGG - Intergenic
1034252285 7:149701927-149701949 TAGGCATCCCTGCAGTCTCAGGG - Intergenic
1035627709 8:1084834-1084856 TGGAGATGCCTGCACTCCCATGG - Intergenic
1040398839 8:47026827-47026849 TGGAAACTCCTGCACTCTCATGG - Intergenic
1041274311 8:56142068-56142090 TGGGCATCCCTGTACTCTCTGGG + Intergenic
1041668447 8:60468391-60468413 TGGTAATCACTGAACTCTCATGG + Intergenic
1042624998 8:70748305-70748327 TGGGCATCCCTGCACTCGCAGGG + Intronic
1042856522 8:73273269-73273291 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1043695099 8:83208009-83208031 CTGGTATTCCTGCACTCTCAGGG + Intergenic
1043737838 8:83769223-83769245 CAGGCATCCCTGCACTCTCAGGG - Intergenic
1044409444 8:91867765-91867787 CAGGCATCTCTGCACTCTCGGGG + Intergenic
1044525089 8:93242206-93242228 TGGGCATCCCTGTGCTCTCAGGG - Intergenic
1044588697 8:93892604-93892626 TAGGCATCCCTTCACTGACAAGG + Intronic
1044775075 8:95678726-95678748 TGGGCATCCCTGTGCTCTTGGGG - Intergenic
1045266052 8:100619511-100619533 TGTGCTTCCCTGAACTCTGATGG - Intronic
1045300833 8:100908561-100908583 CGGGCATCCCTGTGCTCTCGGGG - Intergenic
1045887952 8:107122596-107122618 TGGGCGTCCCGGCACTCTTGGGG + Intergenic
1046459796 8:114518368-114518390 GAGGCATCCCTGCACTCTTGGGG - Intergenic
1046503842 8:115111905-115111927 TGGGCATCTCTGCAATCTCGAGG - Intergenic
1046674770 8:117095071-117095093 TGGGCATCTCTGCACTCTTAGGG - Intronic
1047318452 8:123755465-123755487 TTGGTATCCCTGCTTTCTCAGGG - Intergenic
1047544040 8:125797914-125797936 TGGGCATCTCTGCACTCTTGGGG - Intergenic
1047928292 8:129702044-129702066 GGGTCATCCCTGCACACACATGG + Intergenic
1048037818 8:130693791-130693813 TGGACAGCCCTGCTCTCTCCCGG + Intergenic
1048238445 8:132716127-132716149 CAGGCATCCCTGCACTCTTGGGG + Intronic
1048548056 8:135405174-135405196 CAGGCATCCCTGTGCTCTCAGGG - Intergenic
1048946199 8:139449941-139449963 TGGGTATTACAGCACTCTCATGG + Intergenic
1049140393 8:140949450-140949472 TGGGCATCCCTGCGTTCTTAGGG + Intronic
1049244505 8:141554828-141554850 TGGGCATGCCTGCAGTGCCATGG - Intergenic
1049813293 8:144585911-144585933 GGGGCATCCCTGCACCCCCATGG + Intronic
1049889070 9:51003-51025 TAGGCATCCCTGCTCTCTTTTGG + Intergenic
1050426447 9:5516886-5516908 CAGGCATCTCTGTACTCTCAGGG - Intronic
1050589796 9:7149395-7149417 CGGGCATCCCTGTGCTCTCAGGG - Intergenic
1050941882 9:11471234-11471256 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1051001712 9:12290565-12290587 CAGGCATCCCTGCACTATCTGGG + Intergenic
1052691357 9:31820585-31820607 TGGGCATCCCCGCACTCCTGGGG + Intergenic
1052707468 9:32010713-32010735 CAGGCATCCCTGCACTCTTGGGG + Intergenic
1052708031 9:32016510-32016532 CAGGCATCCCTGCACTCTCAGGG - Intergenic
1053730556 9:41052289-41052311 TAGGCATCCCTGCTCTCTTTTGG + Intergenic
1054697941 9:68379781-68379803 TAGGCATCCCTGCTCTCTTTTGG - Intronic
1055274303 9:74596978-74597000 TCGGCATCCCTTCATTCCCAGGG + Intronic
1055572525 9:77631978-77632000 CAGGCATCCCTGTGCTCTCAGGG + Intronic
1055891001 9:81123099-81123121 TGGGCATCTCTGCACCCTTGGGG - Intergenic
1056986044 9:91364392-91364414 CAGGCATCCCTGCACTCTTGGGG + Intergenic
1057283467 9:93729006-93729028 TGGGCATCCCTTCAATCTAGAGG - Intergenic
1057407563 9:94787294-94787316 TCAGCATGTCTGCACTCTCAAGG - Intronic
1057527009 9:95811714-95811736 TGGGCATCCCTGCAAGCCTATGG - Intergenic
1058077567 9:100666932-100666954 TAGGCATTCCTGCACTCTTGGGG + Intergenic
1059104695 9:111501369-111501391 AGGGCATCCCTGCACTCTGGGGG + Intergenic
1059277567 9:113109012-113109034 TGGGCATCGGTGCCCTCTCTGGG - Intergenic
1059278684 9:113115539-113115561 TGGGCATCGGTGCCCTCTCTGGG + Intergenic
1059401126 9:114071188-114071210 CAGGCATTTCTGCACTCTCAGGG + Intronic
1059681433 9:116590218-116590240 CAGGCATTCCTGCAGTCTCAGGG + Intronic
1059811364 9:117858968-117858990 TCAGCATCCCTGCCCTATCATGG - Intergenic
1060523784 9:124309143-124309165 GGGGCACCACTGCACTCCCAGGG - Intronic
1062184653 9:135211515-135211537 TGGGTATCCCTGCACTCTTGGGG + Intergenic
1062329032 9:136028718-136028740 TGAGCATCTCTGCACTCTTGGGG + Intronic
1062716653 9:138013887-138013909 AGGGCATCTCTGCACTCTTGTGG - Intronic
1203740176 Un_GL000216v2:171504-171526 TAGGCATCCCGGCACCCTCCTGG + Intergenic
1203612431 Un_KI270749v1:21621-21643 CAGGCATCCCTGCACTCTTGGGG - Intergenic
1203620672 Un_KI270749v1:125650-125672 TGGGCATTCCTCTACTCTGATGG + Intergenic
1185935890 X:4257044-4257066 TGATCATCCTTGCACTCTCAGGG + Intergenic
1186187995 X:7040505-7040527 GGAGCATCCCTGTACTCTCCAGG - Intergenic
1186223793 X:7376142-7376164 TGGGCATCCCTGTGCTCTTGGGG - Intergenic
1187871342 X:23767316-23767338 TGGACATCCCTGTGCTCTCGGGG - Intergenic
1188434786 X:30148157-30148179 CGGGCATCCCTGCGCTCTCGGGG + Intergenic
1188647774 X:32591790-32591812 TGGGCATTCCTGCGCTCTTGGGG + Intronic
1188727872 X:33607405-33607427 TGGGCAGCCCTGTACTCTCAGGG - Intergenic
1189856461 X:45229445-45229467 CAGGCATCTCTGCACTCTCGGGG - Intergenic
1190049721 X:47140679-47140701 TGGGCTTCCCTTCACCCTCTTGG - Intergenic
1190360656 X:49645351-49645373 TGGGCATATCTGCACTCTCAGGG - Intergenic
1190912797 X:54788093-54788115 TGGGCTTCCTTGCTCTCTCTCGG - Intronic
1190918157 X:54825283-54825305 TGGGCTTCCTTGCTCTCTCTCGG + Intergenic
1191016254 X:55813395-55813417 TGGGTATCCCTGCACTCTCAGGG + Intergenic
1191105541 X:56769882-56769904 TGAGCGGGCCTGCACTCTCACGG + Intergenic
1191106534 X:56775284-56775306 TGAGCGGGCCTGCACTCTCACGG + Intergenic
1191107527 X:56780686-56780708 TGAGCGGGCCTGCACTCTCACGG + Intergenic
1193417371 X:81240989-81241011 CAGGCATCCTTGCCCTCTCAGGG + Intronic
1194655688 X:96570531-96570553 TGGGCATCCCAGCACTGTCCAGG + Intergenic
1195387828 X:104329742-104329764 TGGGCATCTCTGAACCCGCAGGG - Intergenic
1195464406 X:105164388-105164410 TGGGTAACCCTTCAGTCTCAAGG + Intronic
1195709302 X:107761251-107761273 TGGGCTTCTCTGCCCTCACAAGG - Intronic
1195880393 X:109586754-109586776 CAGGCATCCCTGTACTCTCTAGG - Intergenic
1197609639 X:128623652-128623674 TGGGCATCTCTGCACTCTTGGGG - Intergenic
1198189383 X:134287672-134287694 TGGGCATCCCTGTGCTCTCAGGG + Intergenic
1199861168 X:151801460-151801482 CAGGCATCCCTGCACTCTTGGGG - Intergenic
1200071197 X:153530331-153530353 TGGGCACCCCTCCCCACTCAGGG - Intronic
1200094010 X:153648851-153648873 TGGGCATCTCCTGACTCTCAGGG - Intronic
1201368556 Y:13235272-13235294 CAGACATCTCTGCACTCTCAGGG - Intergenic
1201593292 Y:15638433-15638455 TGGGCATTCTTGTGCTCTCAGGG - Intergenic
1202018265 Y:20434897-20434919 TGGAAATTTCTGCACTCTCAGGG - Intergenic