ID: 1095751855

View in Genome Browser
Species Human (GRCh38)
Location 12:45721403-45721425
Sequence CCTACTGAACTGAAGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095751855_1095751864 30 Left 1095751855 12:45721403-45721425 CCCTTTCCCTTCAGTTCAGTAGG 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1095751864 12:45721456-45721478 AACATATATGTAAAACATGATGG 0: 1
1: 0
2: 3
3: 56
4: 618
1095751855_1095751863 -7 Left 1095751855 12:45721403-45721425 CCCTTTCCCTTCAGTTCAGTAGG 0: 1
1: 0
2: 0
3: 17
4: 204
Right 1095751863 12:45721419-45721441 CAGTAGGGAGTGGGCTAAAAAGG 0: 1
1: 0
2: 2
3: 6
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095751855 Original CRISPR CCTACTGAACTGAAGGGAAA GGG (reversed) Intergenic
903257459 1:22112523-22112545 TTGGCTGAACTGAAGGGAAAAGG + Intergenic
905323717 1:37135315-37135337 CCAGCTGGACTGATGGGAAAAGG + Intergenic
906089267 1:43164557-43164579 CGAACAGAACTGAAGGGAGAGGG + Intronic
909475865 1:76080171-76080193 GTTACTGAACTGAATGTAAAAGG + Intronic
910327786 1:86029899-86029921 GGTACTGAACCGGAGGGAAAGGG + Intronic
910971731 1:92862694-92862716 TCTACTGCTCTGAAGGTAAAAGG + Intronic
911056049 1:93709465-93709487 CCCACTTCACTGAAGGGCAAGGG - Intronic
911736126 1:101338362-101338384 CTTACTGAAGGGAAGGGCAATGG - Intergenic
912415718 1:109507306-109507328 CCTCCTGACCTCAAGGGAATTGG - Exonic
918416999 1:184320342-184320364 CCTGCTGAAGTGAAGGAAGAGGG - Intergenic
918647535 1:186920519-186920541 GCTACTGGACTGAAGGGGACCGG - Intronic
919791815 1:201296130-201296152 TCTCCTGAACTGAAAGGAGATGG - Intronic
919873533 1:201843249-201843271 CCTAATGGACTGATGGGAATGGG - Intronic
919938022 1:202267873-202267895 CCTATTGAATTGAAGACAAAGGG + Intronic
920760796 1:208782052-208782074 CCCACTGAATAGAAGTGAAAGGG + Intergenic
921551255 1:216537994-216538016 CCTGCAGAAAGGAAGGGAAAAGG - Intronic
922135596 1:222822230-222822252 CCTTCTGAACACAAGTGAAATGG - Intergenic
922462941 1:225826979-225827001 CCTACAGAACTGCAGGAATAAGG + Intronic
924315566 1:242791885-242791907 CCTAATGCACTGAAAGGAAAGGG + Intergenic
924495614 1:244585707-244585729 CCTGCTGGACCGAAGGGACATGG + Intronic
924513461 1:244747461-244747483 CCTGTTGAACTAAAAGGAAAGGG + Intergenic
1062795138 10:339152-339174 CCTGCTGAACTGCATGGGAAAGG + Intronic
1063376032 10:5554973-5554995 CCTGCTGAAGTGGAGAGAAAAGG + Intergenic
1065185560 10:23167408-23167430 CCTTTTGAACTTAATGGAAATGG - Intergenic
1065804590 10:29382905-29382927 GCTTCTGCACTGAAGGAAAAGGG + Intergenic
1065944541 10:30594827-30594849 GCTTCTGCACTGAAGGAAAAGGG - Intergenic
1069253926 10:66308925-66308947 CTTACTCTACTTAAGGGAAATGG + Intronic
1071886250 10:89953371-89953393 CCTACTGAACAGCTTGGAAATGG + Intergenic
1073660067 10:105465155-105465177 CCCACTGAACTGCAAGTAAAAGG + Intergenic
1079146969 11:17861501-17861523 CCTACTGTACAGTGGGGAAATGG - Intronic
1082233034 11:49792387-49792409 CCTACTGAAAAGGAAGGAAAAGG + Intergenic
1083197326 11:61096323-61096345 GCTACTGGACTGAAGGGGACCGG + Intergenic
1085757955 11:79217175-79217197 CCTACTCAAAAGAAGGGTAAGGG + Intronic
1086540142 11:87899270-87899292 TCTAATGAACTGGAAGGAAATGG + Intergenic
1086926843 11:92649951-92649973 CCTACAGAAATAAAGTGAAAAGG - Intronic
1087833479 11:102845671-102845693 CACACTGAACTGTAGTGAAATGG + Intergenic
1087935961 11:104035150-104035172 CCTACAGAACTGATGTCAAATGG + Intronic
1088530244 11:110800187-110800209 ACTACTGAACACAAGGGAAGTGG - Intergenic
1089076941 11:115745851-115745873 CCCAGTCAAGTGAAGGGAAATGG + Intergenic
1090117723 11:123992553-123992575 CCTACAGAACTGCAGTGCAATGG - Intergenic
1091189221 11:133676080-133676102 CCAAATGAACTGAAGGAACATGG + Intergenic
1093674179 12:21915738-21915760 CCTATTGATCTGAAGGCAATTGG - Exonic
1095751855 12:45721403-45721425 CCTACTGAACTGAAGGGAAAGGG - Intergenic
1096534556 12:52263037-52263059 TCTATTTAACTGAAGGAAAAGGG + Intronic
1098061458 12:66567710-66567732 TCTGCTCAACTGAAGGGGAATGG - Intronic
1098207980 12:68133005-68133027 TCTCCTCAAGTGAAGGGAAAAGG + Intergenic
1101455541 12:104826696-104826718 CCTACAGAACTTAAAGCAAATGG + Intronic
1101556710 12:105816822-105816844 CCCACAGAAGGGAAGGGAAAGGG + Intergenic
1101673397 12:106896958-106896980 CCTAATGTACTGATGGGAAGTGG + Intergenic
1102097059 12:110249321-110249343 CCAGCTGCACTGAGGGGAAATGG - Intergenic
1106605880 13:31228300-31228322 CCTTCTGAACTCATGGGAGATGG + Intronic
1107100922 13:36591369-36591391 CAAACAGAACTGAAAGGAAATGG - Intergenic
1107650730 13:42542097-42542119 CCTTAAAAACTGAAGGGAAAAGG - Intergenic
1108281699 13:48868143-48868165 CCAACTGAACACAAGGCAAATGG - Intergenic
1110356910 13:74577181-74577203 CCTACTGAATTGAAGGTCTATGG - Intergenic
1111145765 13:84177084-84177106 CATACTGCATGGAAGGGAAAGGG - Intergenic
1114870396 14:26648740-26648762 CCTACAGGACTCAAAGGAAAGGG - Intergenic
1115611023 14:35048799-35048821 CCTAGTGCAATGTAGGGAAAGGG + Intronic
1118302822 14:64630518-64630540 CCTACTGTACAGATGAGAAAAGG + Intergenic
1118331254 14:64817694-64817716 CCTCCTGTACATAAGGGAAAAGG + Intronic
1118887369 14:69878620-69878642 CCCTCTGAACTGGAGGGCAAGGG - Intronic
1119388781 14:74276209-74276231 CCTCCTGAGCAGAAGGGCAAGGG + Intergenic
1123135136 14:106021208-106021230 CCACCTGAGCTGCAGGGAAAGGG + Intergenic
1123164514 14:106313930-106313952 CCACCTGAGCTGCAGGGAAAGGG + Intergenic
1123585688 15:21759078-21759100 CCACCTGAGCTGCAGGGAAAGGG + Intergenic
1123622330 15:22201666-22201688 CCACCTGAGCTGCAGGGAAAGGG + Intergenic
1123671779 15:22665563-22665585 CTTACTGAACTTAAGGGGACGGG + Intergenic
1124094123 15:26632942-26632964 CCTCCAGAACTGAATGAAAAAGG + Intronic
1125093259 15:35820198-35820220 TCTACTGATCATAAGGGAAAAGG - Intergenic
1125209561 15:37197447-37197469 TCTTCTGAAAGGAAGGGAAACGG - Intergenic
1126108030 15:45159802-45159824 CCCACTGGACTGAAGGGGTAGGG - Intronic
1129455489 15:75674387-75674409 TCTACTGAACTGAAGGGGTTTGG + Exonic
1133839646 16:9395883-9395905 GCTGCTGAAGTTAAGGGAAAGGG - Intergenic
1134827898 16:17299187-17299209 CCTACTGCACTTAAGGCAGACGG + Intronic
1136044367 16:27603547-27603569 CCAACTGCAGTGAAGGGAAGAGG + Intronic
1137743081 16:50799983-50800005 GCTACTTAGCTGAAGGGTAAGGG + Exonic
1139730892 16:68944373-68944395 CTTTCCCAACTGAAGGGAAAAGG + Intronic
1139798289 16:69500371-69500393 GCTTCTGATCTGGAGGGAAAGGG + Intergenic
1141673912 16:85507534-85507556 CCTCCAGAACTGCAAGGAAATGG - Intergenic
1141809650 16:86367030-86367052 CCTATTGTAATGAAGGGATAAGG - Intergenic
1142367162 16:89656831-89656853 CCTACCGAGCTGGCGGGAAAGGG + Intronic
1143049502 17:4112580-4112602 CCAACAGAACTGAGGGGATAGGG - Intronic
1143903296 17:10190644-10190666 CCTACTGAACAGGAGAGGAAAGG + Intronic
1149064892 17:52467597-52467619 CCTACTCATCTCAAGGGAAAAGG + Intergenic
1150169226 17:62974737-62974759 CTTACTGAACTTCAGGGAAGTGG - Intergenic
1150544269 17:66137030-66137052 CCTAAAGAAATGAAGGTAAATGG + Intronic
1155570227 18:27184919-27184941 TCCACTGAAGTGAAGGGAAGTGG + Intronic
1159003627 18:62993823-62993845 CCCAGTGAAATGAAGGGAAAAGG + Intergenic
1163184213 19:15626115-15626137 ACTACAGAACTGAAGAGAAAAGG - Intronic
1163840538 19:19606139-19606161 CTTCCTGAACTCAAGGAAAAAGG - Intronic
1164841185 19:31393507-31393529 CCTACTAAAGTCAAGGGCAAAGG - Intergenic
1165656146 19:37533908-37533930 CTTACAGAGCTGAAGGGAGAGGG - Intronic
1167032175 19:46969981-46970003 CCTACTGAACTGTGAGGAATTGG + Intronic
1167708453 19:51095857-51095879 TCCAATGAACAGAAGGGAAAAGG + Intergenic
1168540609 19:57206680-57206702 CCTTCTGAACTCTAGGGAATAGG + Intronic
925473697 2:4189589-4189611 CATACTGAAATGAAGGACAAGGG + Intergenic
926893666 2:17660716-17660738 GCTGCTGTTCTGAAGGGAAAAGG + Intergenic
927394689 2:22636328-22636350 CCTACTGAGATGAAGAAAAATGG - Intergenic
927629968 2:24764605-24764627 CCAAATCAACTGAAGGTAAAGGG + Intronic
931123482 2:59247296-59247318 ATGACAGAACTGAAGGGAAAAGG - Intergenic
931219625 2:60277477-60277499 CCTCAGGATCTGAAGGGAAAGGG + Intergenic
931690178 2:64829088-64829110 CCTACTGCACTAAAAAGAAAGGG - Intergenic
932452673 2:71824509-71824531 CCTAATGTAATGTAGGGAAAAGG - Intergenic
935235192 2:101132422-101132444 CATACTGTACTGAAGGGAGCAGG - Intronic
936052431 2:109235024-109235046 CCTACTGGGCTGAAGGGACCAGG - Intronic
937965334 2:127503150-127503172 CCTACTGAACTTCATGTAAATGG + Intronic
940394693 2:153174334-153174356 CATCCTGGACTGAAGGGTAAAGG - Intergenic
946486544 2:220105944-220105966 CTTACAGAACTGAAGGAAGATGG - Intergenic
1170129396 20:13002424-13002446 CCTACTGACCTGAGGGGCAATGG - Intergenic
1175576358 20:60063601-60063623 CCTTCTGCAGTGAAGGGAATAGG + Intronic
1177818472 21:26003930-26003952 CCTACTCTACTACAGGGAAAGGG + Intronic
1179303443 21:40133764-40133786 CCTGATGAACTGCAGGGTAAAGG + Intronic
1179974535 21:44856627-44856649 CATAATGAACTGAAGTGACAGGG + Intronic
1182874463 22:33678998-33679020 CCTGCTGAATTGAAGGGATCCGG - Intronic
1184361570 22:44022299-44022321 CCTCCTTTACTGAAAGGAAAAGG + Intronic
953189180 3:40667684-40667706 CCTACTGAACTCTGGGGGAAGGG + Intergenic
953565006 3:44024647-44024669 GCTAGTGATCTGAAGGGTAATGG - Intergenic
957333458 3:78795883-78795905 CCTACTGAAAAGGAAGGAAAAGG + Intronic
958981029 3:100720014-100720036 CCTACTGCACTGAATTGCAAAGG - Exonic
960360268 3:116702641-116702663 CTTGCTGAAATAAAGGGAAAGGG + Intronic
964499160 3:157329328-157329350 CCACCTGAACTGAAGGCAACAGG + Intronic
967198386 3:187049417-187049439 CTCATAGAACTGAAGGGAAAAGG - Intronic
967760722 3:193223180-193223202 CTGACAGAAATGAAGGGAAAAGG - Intergenic
968745461 4:2357551-2357573 CCTACTGCTCTGAAGGGGAGCGG - Intronic
969389845 4:6884284-6884306 CATTGTGAACTGAAGAGAAATGG + Intergenic
972011962 4:34194274-34194296 CCTACAGCAATGAAGGCAAATGG - Intergenic
972083490 4:35183183-35183205 CCTTCTTAACTGAAATGAAATGG + Intergenic
974526366 4:63054136-63054158 CCTATTCAACTGAGGGCAAAAGG + Intergenic
974931758 4:68367881-68367903 CCTATTTAACTAAAGGTAAAGGG - Intergenic
975636988 4:76460223-76460245 TTTACTGAATTGAAGGCAAATGG - Intronic
976253355 4:83075836-83075858 TCTGCTGAACCGAAGGAAAAGGG - Intergenic
976617823 4:87096112-87096134 CTTTGTGAAATGAAGGGAAAAGG + Intronic
976942048 4:90714296-90714318 CCTAATGAACTTAAGGTAATTGG + Intronic
977402558 4:96551361-96551383 GATACTAGACTGAAGGGAAAAGG - Intergenic
977656166 4:99523209-99523231 TTTACTGAATTGAAGGAAAAAGG + Intronic
978010755 4:103680273-103680295 CCTACAGAACAGAAAGAAAATGG + Intronic
980779815 4:137480884-137480906 GCTACTGGACTGAAGGGGATGGG + Intergenic
982796560 4:159653254-159653276 CCTTCTGAATTGAAGTGACAGGG - Intergenic
983944436 4:173569583-173569605 TCTACTAAACTGATGGGAAGGGG - Intergenic
984303639 4:177957153-177957175 CTTAATGAACTCAAAGGAAAAGG + Intronic
987081957 5:14433360-14433382 CCTCCTGCTCTGGAGGGAAAGGG - Intronic
988385653 5:30561231-30561253 CCTTGTGAACTCAGGGGAAAGGG + Intergenic
989537777 5:42583334-42583356 CCTAGTTGACTGAATGGAAAAGG - Intronic
989566446 5:42905966-42905988 GCTCCTGAACACAAGGGAAAAGG - Intergenic
990010707 5:50994197-50994219 CCTAATGAAAGGAAAGGAAATGG - Intergenic
992097428 5:73375946-73375968 TTTATTGAACTGAAGGGAAAGGG + Intergenic
992305749 5:75435779-75435801 CCTGCTGTACTGGAGGGATAAGG + Intronic
994751625 5:103745090-103745112 GCTACTGAAATCAAGGGAGACGG - Intergenic
997917859 5:137946933-137946955 CCAACTCAGATGAAGGGAAATGG - Intronic
998573270 5:143284858-143284880 CATACTGCAGTGAAGGGAAAGGG + Intronic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999662175 5:153876524-153876546 TGGACTGAACTGAAGGGAAAAGG - Intergenic
999692347 5:154159049-154159071 CTTTCTGAACTCAAGGGAGAAGG - Intronic
1000442871 5:161283850-161283872 CAAACTGGACTGAAGAGAAATGG - Intergenic
1000699388 5:164429444-164429466 TCTACAGAACTGATGGGAATGGG + Intergenic
1000781370 5:165486581-165486603 CCCACAGAAGTAAAGGGAAATGG - Intergenic
1001927304 5:175647849-175647871 CCATGAGAACTGAAGGGAAATGG - Intergenic
1002065283 5:176648529-176648551 CTTGCTGAACACAAGGGAAAAGG - Intronic
1004005262 6:11632273-11632295 CCTGCTGAAATGAAAAGAAAAGG - Intergenic
1004005605 6:11634659-11634681 CCTGCTGAAATGAAAAGAAAAGG - Intergenic
1004411627 6:15386462-15386484 TCAACTGTACTGAAGGGAGAAGG - Intronic
1006433193 6:34010866-34010888 CCAACTGAAATGAAGGGACAGGG + Intergenic
1008301372 6:49844599-49844621 CTCACTGAGCTAAAGGGAAAAGG + Intronic
1011565353 6:88666949-88666971 CCTATTGAACTCAGGGGGAAAGG + Intronic
1011641673 6:89421671-89421693 CTTACTGAACAGATGTGAAAGGG - Intergenic
1012590865 6:100978899-100978921 CCTACACAACAGAAAGGAAATGG - Intergenic
1014547075 6:122746651-122746673 GCTACTGGACTGAAGGGGACCGG - Intergenic
1018212728 6:161497661-161497683 CCTTCTGAATTGAAAGGGAAAGG - Intronic
1018843567 6:167537452-167537474 CCTACAGGACTCAAAGGAAAGGG + Intergenic
1019403876 7:872351-872373 CTTACTGATGTGGAGGGAAACGG + Intronic
1019895527 7:3979531-3979553 CCTACTGAGCTGAAATGAGACGG + Intronic
1020661041 7:10982905-10982927 CCTACTGTAGTAAAGAGAAAAGG + Exonic
1021136593 7:16971959-16971981 CCTGCTTAACTGCAGGGAAGAGG + Intergenic
1024474251 7:49793406-49793428 ACTTCTGAACAGAAAGGAAAGGG - Intronic
1027944000 7:84722753-84722775 CCTACTGAACTCCTGGGGAAGGG + Intergenic
1028635257 7:92981547-92981569 TCTACACAACTGAAGGTAAAAGG - Intergenic
1029299827 7:99571916-99571938 TCAACCTAACTGAAGGGAAAAGG - Intronic
1030158387 7:106481042-106481064 CCAACTGAGCTGAAGGGGATGGG + Intergenic
1031092239 7:117372406-117372428 CATACTGATCTCATGGGAAAGGG - Intronic
1032448283 7:132003472-132003494 TCTCCTGAAATGAAGGGATAAGG - Intergenic
1033300762 7:140183037-140183059 TTTACTGAGCTGGAGGGAAAAGG + Intergenic
1037695589 8:21221337-21221359 CCTACTGAACTGTGGGGAGCTGG - Intergenic
1041223816 8:55678186-55678208 CCCACTGAAATGGAGGGAGATGG - Intergenic
1041405059 8:57489703-57489725 ACTTCTGAACTGAACTGAAATGG + Intergenic
1049281529 8:141751513-141751535 CCTACTGATGGGAATGGAAATGG + Intergenic
1051547974 9:18297749-18297771 TCCTCTTAACTGAAGGGAAAGGG + Intergenic
1051566161 9:18500748-18500770 CATATTGAACTTGAGGGAAAAGG - Intronic
1052201074 9:25781021-25781043 TCTTCTGTACTGAAGGAAAAGGG - Intergenic
1053008243 9:34618590-34618612 CCTAATGAACTGAAGGGCTAGGG + Intronic
1055197440 9:73613336-73613358 CATACTGAACTGAAGTTAAATGG - Intergenic
1055594259 9:77849515-77849537 CCAGCTAAACTGAAGGAAAATGG + Intronic
1055771278 9:79719368-79719390 CCTAAGGAACTCAAGGGAAAAGG - Intronic
1055795015 9:79966647-79966669 CCAACTGAAGAGAAAGGAAAGGG + Intergenic
1057950058 9:99362669-99362691 CCTATTGCACTGATGAGAAAAGG - Intergenic
1059057838 9:111003294-111003316 CCTACTAAACTCCAGGGATAGGG - Intronic
1059395234 9:114030154-114030176 CCTCCTGAACTGAGGAGTAAAGG - Intronic
1061574894 9:131500083-131500105 GGTACTGAACCGGAGGGAAAGGG - Exonic
1190429712 X:50367507-50367529 CCCTCTGTACTCAAGGGAAAAGG + Exonic
1192253075 X:69429712-69429734 TCATCTGAACTGAAGGGAATAGG + Intergenic
1192325939 X:70132167-70132189 CCTACCCAACTGAAGGTTAATGG + Intergenic
1193953644 X:87830547-87830569 CCTATTGAAAAGAAGGCAAAGGG - Intergenic
1194280189 X:91941974-91941996 CATTTTGAACTGAATGGAAATGG + Intronic
1195468727 X:105210186-105210208 CCTCTGGAACAGAAGGGAAAAGG - Intronic
1195703332 X:107721220-107721242 CCTCCTGAAATGAAGGGAATTGG - Intronic
1196024982 X:111032721-111032743 ATTACTGAAGTGAAGGGAGAAGG + Intronic
1196517321 X:116628797-116628819 CCTACTGAACTCCTGGGGAAAGG - Intergenic
1196855473 X:119978941-119978963 AAAACAGAACTGAAGGGAAAGGG - Intergenic
1197374991 X:125671931-125671953 CTTACTGAGCTGAAGGGCAAGGG + Intergenic
1200239166 X:154484862-154484884 TTTACTGAACAGAAGGGAGAGGG + Exonic
1200597667 Y:5165469-5165491 CATTTTGAACTGAATGGAAATGG + Intronic
1200684938 Y:6249627-6249649 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1200990468 Y:9340898-9340920 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1200993130 Y:9361215-9361237 CTTACAGAAGTGAGGGGAAAGGG + Intronic
1200995784 Y:9381485-9381507 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1200998448 Y:9401837-9401859 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1201000958 Y:9470367-9470389 CTTACAGAAGTGAGGGGAAAGGG + Intronic
1201003625 Y:9490695-9490717 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1201006281 Y:9510977-9510999 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1201008939 Y:9531286-9531308 CTTACAGAAGTGAGGGGAAAGGG + Intergenic
1201219193 Y:11750244-11750266 CCTAATGCACTGAAAGGAAAGGG + Intergenic
1201782511 Y:17739160-17739182 CTTACTTAACTAAAGGGAAAAGG - Intergenic
1201819042 Y:18166828-18166850 CTTACTTAACTAAAGGGAAAAGG + Intergenic