ID: 1095753028

View in Genome Browser
Species Human (GRCh38)
Location 12:45730580-45730602
Sequence AACTCAAAATTAGCGCGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095753028 Original CRISPR AACTCAAAATTAGCGCGGGC AGG Intronic
902058942 1:13625425-13625447 AACACAAAATTAGCCGGGCCTGG - Intergenic
903201704 1:21745429-21745451 AACTAAAAATTAGCTGGGCCTGG + Intronic
913018726 1:114765196-114765218 AACTCAAAATTAGCTGGGCGTGG - Intergenic
913677123 1:121151239-121151261 AACACAAAATTAGCTGGGGGTGG + Intergenic
914028959 1:143938867-143938889 AACACAAAATTAGCTGGGGGTGG + Intergenic
914160492 1:145129081-145129103 AACACAAAATTAGCTGGGGGTGG - Intergenic
915388713 1:155520704-155520726 AACACAAAATTAGCTCGGTGTGG + Intronic
920109866 1:203580228-203580250 AACTCAAAATTAGCTGGGCATGG - Intergenic
920464424 1:206169756-206169778 AACACAAAATTAGCTGGGGGTGG + Intergenic
922939385 1:229448270-229448292 AATACAAAATTAGCCAGGGCTGG + Intronic
1065541100 10:26768380-26768402 AACTCAAAATTAGCCAGGCGTGG + Intronic
1067104010 10:43353058-43353080 AACACAAGATTAGGCCGGGCGGG - Intergenic
1069036289 10:63649070-63649092 AACACAAAATTAGCCGGGCCTGG + Intergenic
1069771351 10:70902272-70902294 AATACAAAATTAGCCAGGGCTGG - Intergenic
1073809583 10:107137704-107137726 AACACAAAATTAGCTGGGCCTGG + Intronic
1080484440 11:32690679-32690701 AACTTAAAATCATGGCGGGCGGG - Intronic
1080650464 11:34218691-34218713 AACACAAAATTAGCCAGGGGTGG + Intronic
1082062293 11:47871321-47871343 AATACAAAATTAGCCCGGGGTGG - Intergenic
1082162881 11:48902810-48902832 AATACAAAATTAGCGGGGGGCGG - Intergenic
1083803329 11:65058922-65058944 AACTCAAAATCTGCTCAGGCAGG - Intergenic
1084083698 11:66845013-66845035 AACTCCAAAAAAGAGCGGGCAGG - Exonic
1084130848 11:67133253-67133275 AACACAAAATTAGCGCAGTGTGG - Intronic
1084160301 11:67345147-67345169 AACTAAAAATTAGCTCGGTGTGG - Intronic
1089154308 11:116388943-116388965 AACACAAAATTAGCCAGGCCTGG - Intergenic
1092354054 12:7779817-7779839 AACAAAAAATTAGCCAGGGCTGG + Intergenic
1092621369 12:10274122-10274144 AACACAAAATTAGCTGGGGGTGG + Intergenic
1095753028 12:45730580-45730602 AACTCAAAATTAGCGCGGGCAGG + Intronic
1099462965 12:82946895-82946917 TACACAAAATTAGCCCGGGGTGG - Intronic
1099536660 12:83854520-83854542 AACTCAAAATGAGATTGGGCAGG - Intergenic
1100883343 12:99042196-99042218 AACTCAAAATCAGCTTGGGAGGG - Intronic
1103460659 12:121102198-121102220 ACCCCAAAATTAGCCCGGGAGGG + Intergenic
1103695840 12:122814797-122814819 AAATTAAAATTAGGCCGGGCAGG - Intronic
1104694550 12:130853382-130853404 AAAACAAAATTAGCTAGGGCTGG - Intergenic
1106255515 13:28019121-28019143 AACACAAAATTAGCTGGGCCTGG - Intronic
1108689974 13:52851046-52851068 AACCCAAACTTAGCGCGTGGCGG - Intergenic
1112650678 13:101393649-101393671 AATACAAAATTAGCCCGGGGTGG + Intronic
1116816958 14:49592750-49592772 AACACAAAATTAGCCCGGCGTGG + Intronic
1122873584 14:104652406-104652428 AACACAAAATAAGAGTGGGCAGG - Intergenic
1126267703 15:46773860-46773882 AACTCAAAATTGGCGAGGGGAGG + Intergenic
1129576166 15:76748144-76748166 AATACAAAATTAGCGCGGCATGG - Intronic
1136547790 16:30965369-30965391 TCCTCAAAATTAGCTGGGGCCGG - Exonic
1138752205 16:59437468-59437490 AATACAAAATTAGCCAGGGCTGG - Intergenic
1143094286 17:4468941-4468963 AACACAAAATTAGCTGGGCCTGG - Intronic
1143647870 17:8243361-8243383 AACACAAAATTAGCTGGGGGTGG + Intronic
1144272795 17:13634788-13634810 AACACAAAATTAGCCAGGCCTGG + Intergenic
1146188608 17:30745506-30745528 AACTCAAAATTAGCTGGGTGTGG - Intergenic
1151214497 17:72568429-72568451 TACTAAAAATTAGCCCAGGCTGG - Intergenic
1151796645 17:76350874-76350896 AACACAAAATTAGCGGGGTGTGG + Intronic
1153042567 18:827718-827740 AACACAAAATTAGCCAGGGGTGG - Intergenic
1153372427 18:4334080-4334102 AACACAAAATTAGCTGGGGGTGG + Intronic
1154262597 18:12850331-12850353 AACACAAAATTAGCCAGGCCTGG + Intronic
1159917476 18:74199718-74199740 AACTAAAAATTAGCTGGGCCTGG + Intergenic
1161319832 19:3635999-3636021 AACTCAAAATTAGCCAGGCATGG + Intronic
1163102301 19:15105676-15105698 AACACAAAATTAGCTGGGGGTGG - Intergenic
1164271645 19:23677962-23677984 AATACAAAATTAGCACGGGGTGG + Intronic
1165025415 19:32957511-32957533 AAATAAAAATTAGCCTGGGCTGG + Intronic
1167893331 19:52560168-52560190 AACTAAAAATTAGCCAGGCCTGG + Intronic
1167898932 19:52603720-52603742 AACACAAAATTAGCCAGGGGTGG + Intronic
1168457293 19:56522890-56522912 AACACAAAATTAGCGGGGCATGG - Intronic
1168632715 19:57969748-57969770 AACACAAAATTAGCGGGGCATGG + Intronic
925593573 2:5533682-5533704 AACTCAAAATTAGCCGGGTGTGG - Intergenic
926723085 2:15977233-15977255 AACACAAAATTAGCTGGGGGTGG - Intergenic
928703504 2:33923230-33923252 AACTAAAAATTAGCCGGGCCTGG - Intergenic
928984686 2:37169648-37169670 ATATAAAAATTAGCTCGGGCTGG - Intronic
929597025 2:43182445-43182467 AACACAAAATTAGCTGGGGGTGG + Intergenic
929968910 2:46556286-46556308 AACTGAAAAAGAGCGGGGGCAGG - Intronic
930162083 2:48168718-48168740 AACTCAAAATTAGCTGGGTGTGG + Intergenic
932149934 2:69361680-69361702 AACTAAAAATCAGCAAGGGCTGG + Intronic
933072785 2:77882014-77882036 AGCACAAAATTAGCGAGGCCTGG - Intergenic
933665614 2:84962195-84962217 AACTTAAAATTAGCTGGGCCTGG + Intergenic
937090620 2:119203942-119203964 AACACAAAATTAGCCAGGCCTGG + Intergenic
939533402 2:143393573-143393595 AACACAAAATTAGCCAGGCCTGG + Intronic
939715516 2:145578981-145579003 AACACAAAATTAGCCGGGGTTGG + Intergenic
941784045 2:169479052-169479074 AACCCAAAATTAGCCAGGGGTGG - Intergenic
947404735 2:229762848-229762870 ACCTCAACATTAGCTGGGGCCGG - Intergenic
947700234 2:232228120-232228142 AACACAAAATTAGCCGGGCCTGG - Intronic
1173479515 20:43388169-43388191 AACACAAAATTAGCCAGGCCTGG + Intergenic
1174085812 20:48006490-48006512 AATACAAAATTAGCCAGGGCTGG - Intergenic
1176014838 20:62925833-62925855 AACTGAAAACCAGCGCGGGGAGG + Intronic
1178246761 21:30960532-30960554 AACACAAAATTAGCTGGGCCTGG + Intergenic
1178341221 21:31786878-31786900 TACTCAAAACTAGCACAGGCTGG - Intergenic
1178863215 21:36306498-36306520 AACTCAAAGTTGGCGGGGGGTGG + Intergenic
1179460540 21:41531787-41531809 AACACAAAATTAGCCCGGCGTGG - Intergenic
1180606647 22:17064094-17064116 AAATCAAAATCAGCTCGTGCTGG - Intergenic
1183723528 22:39575928-39575950 AATTCAAAATTAGCCCGGCATGG - Intronic
952460186 3:33516509-33516531 AACACAAAATTAGCCGGGGGTGG + Intronic
966839148 3:184074613-184074635 AACACAAAATTAGCCGGGGATGG + Intergenic
972033939 4:34497015-34497037 AACACAAAATTAGCCCGGCGTGG - Intergenic
973926012 4:55738289-55738311 AACTCAAAATTAGCCAGGCATGG + Intergenic
975336287 4:73179753-73179775 AACTTAAAATTAGCCAGGCCTGG - Intronic
978684748 4:111426630-111426652 AACACAAAATTAGCCAGGCCTGG + Intergenic
981075742 4:140589529-140589551 AACGCAAAATTAGCCGGGGTTGG - Intergenic
981220210 4:142223085-142223107 AACTGAAAATTAGAGCGGCTAGG + Intronic
984737390 4:183122673-183122695 AACACAAAATTAGCTAGGGGTGG - Intronic
992075432 5:73188594-73188616 AACTCAAAATTAGCCAGGCATGG - Intergenic
993582682 5:89682177-89682199 AACTCAAAATTAGCCAGGTGTGG + Intergenic
993764893 5:91844140-91844162 AACTCAATAATAGCTTGGGCTGG + Intergenic
998216917 5:140244417-140244439 AATACAAAATTAGCCCGGCCTGG - Intronic
999989897 5:157040140-157040162 AACACAAAATTAGCCAGGCCTGG + Intronic
1000759408 5:165203712-165203734 GACTCAAAATGAGCACAGGCAGG - Intergenic
1000770764 5:165350992-165351014 AACAAAAAATTAGCCCGGGGTGG - Intergenic
1006938981 6:37738833-37738855 AACACAAAATTAGCCAGGCCTGG + Intergenic
1010141216 6:72617194-72617216 AACTAAAAATTAGCTGAGGCAGG - Intergenic
1022526426 7:31040743-31040765 AATTAAAAATTAGCGCAGTCAGG - Intergenic
1027138697 7:75641651-75641673 AATACAAAATTAGCCGGGGCTGG - Intronic
1029692467 7:102191387-102191409 AATACAAAATTAGCCCGGGGTGG - Intronic
1033342435 7:140502567-140502589 AACAAAAAATTAGGCCGGGCGGG + Intergenic
1034381264 7:150695598-150695620 ATCTCAAGATTAGTGTGGGCAGG - Intergenic
1036387245 8:8293194-8293216 AACACAAAATTAGCTGGGCCCGG - Intergenic
1038595745 8:28884337-28884359 AACTAAAAATTAGCTAGGCCTGG - Intronic
1040699365 8:50042407-50042429 AACTGAAAACTTCCGCGGGCTGG + Intronic
1041241286 8:55851100-55851122 AACGGAAAAGAAGCGCGGGCCGG - Intergenic
1041790341 8:61689746-61689768 AACTCAAAAGTACTGCTGGCAGG + Intronic
1044001405 8:86885805-86885827 AACTCAAAAATAGAATGGGCTGG - Intronic
1044575206 8:93761141-93761163 AACTCAAAATTAGCCTGGCATGG + Intronic
1046806448 8:118484446-118484468 TAATAAAAATTAGAGCGGGCTGG + Intronic
1048589159 8:135804991-135805013 AAATGAAAACTAGAGCGGGCAGG + Intergenic
1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG + Intronic
1057132279 9:92662368-92662390 AACACAAAATTAGCCCGGCGTGG + Intronic
1190191412 X:48280270-48280292 AACAAAAAAATAGCGTGGGCGGG - Intergenic
1190667510 X:52708563-52708585 AACAGAAAAATAGCGTGGGCGGG - Intergenic
1190671908 X:52749845-52749867 AACAGAAAAATAGCGTGGGCGGG + Intergenic
1193110437 X:77724120-77724142 AACACAAAATTAGCCGGGCCTGG + Intronic
1195892378 X:109709947-109709969 AACACAAAATTAGCCGGGCCTGG + Intronic