ID: 1095756317

View in Genome Browser
Species Human (GRCh38)
Location 12:45770735-45770757
Sequence CAGAGGCACCACTCAGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 1, 2: 33, 3: 118, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095756313_1095756317 2 Left 1095756313 12:45770710-45770732 CCTAGTATGCAGAGAAAGGCTAA 0: 1
1: 0
2: 0
3: 9
4: 169
Right 1095756317 12:45770735-45770757 CAGAGGCACCACTCAGAGGTGGG 0: 1
1: 1
2: 33
3: 118
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095756317 Original CRISPR CAGAGGCACCACTCAGAGGT GGG Intronic
900437292 1:2637174-2637196 CAAAGGTACCACTCAAAGGTGGG + Intronic
902657889 1:17882034-17882056 CAGACTCACCAATCAGAGGCTGG + Intergenic
902748501 1:18489835-18489857 CAGTGGCCTCACTCACAGGTTGG - Intergenic
903211478 1:21821727-21821749 CAGCGCCACCCCTCAGAGCTGGG - Intronic
904344892 1:29861323-29861345 CAAAAGCACTACTCAAAGGTGGG + Intergenic
904518083 1:31072402-31072424 TAAAGACACCACTCAAAGGTGGG + Intergenic
906221386 1:44082569-44082591 CAGATTCAACACTCAGAGATAGG + Intergenic
906636290 1:47412656-47412678 CAGGGGCTCCACTCAGACGCTGG + Intergenic
907615921 1:55926777-55926799 CAAAGTCACCACTCAAAGGTGGG - Intergenic
908435114 1:64098254-64098276 CTGAGTCCCCACCCAGAGGTAGG + Intronic
908675278 1:66596451-66596473 CAAAGACATCACTCAGATGTGGG + Intronic
909360215 1:74750741-74750763 CAGAGGCACCACTTATCTGTGGG - Intronic
910036063 1:82790655-82790677 CAAAGGCACCACTCAAACGTGGG - Intergenic
911608565 1:99935978-99936000 GAAAGGCACCACTCAAAGGTGGG - Intergenic
912449795 1:109761792-109761814 CAGAGGCAGCCATCAGAGCTGGG + Intronic
912968686 1:114259988-114260010 CACAGTCACCACACTGAGGTGGG + Intergenic
914355631 1:146881947-146881969 CAGAGGCAACTCTCACAGGAAGG + Intergenic
914411233 1:147429726-147429748 GTGAGGCACCTCTCATAGGTAGG + Intergenic
914796766 1:150926450-150926472 CAGACTCACAACTCAGGGGTCGG - Exonic
917067565 1:171113344-171113366 CAGAGGCACCAATCAGGTGAAGG - Intronic
917371895 1:174301780-174301802 CAAAGGCAACACTCAAAGTTGGG + Intronic
918245041 1:182651782-182651804 CAGAGGCTACAGGCAGAGGTTGG + Intronic
918775277 1:188620752-188620774 CAAAGACATCACTCAAAGGTGGG + Intergenic
920037204 1:203073978-203074000 CCCAGGCACTGCTCAGAGGTTGG + Intronic
920627163 1:207613353-207613375 CAAAGACACCACTCAAAGGTGGG + Intronic
920637109 1:207714284-207714306 CAAAGCCACCACTCAAAGGTGGG + Intronic
921014421 1:211175398-211175420 CAAAGACAGCACTCAAAGGTGGG - Intergenic
921159062 1:212460388-212460410 CAGAGGCCCTGCTCAGAGGCTGG - Intergenic
922182574 1:223246749-223246771 CAAGGCCACCACTCAGAGGTGGG + Intronic
922334091 1:224605052-224605074 CAAAGACACCACTCAAAGGTGGG + Intronic
924319867 1:242838454-242838476 TGAAGGCACCACTCAAAGGTGGG - Intergenic
1062854088 10:770587-770609 CAGAGGCACCTCTGGGAAGTGGG + Intergenic
1063400315 10:5737475-5737497 CAGAGGCACAACGCAGAGAGGGG - Intronic
1063631050 10:7734246-7734268 CAAATGCACCACTCTGATGTGGG + Intronic
1065613079 10:27491593-27491615 CAAAGGCACCACTCAAAGGTGGG + Intergenic
1065640697 10:27779192-27779214 CTGAGGCAACTCTGAGAGGTTGG + Intergenic
1067662397 10:48246302-48246324 CAGAGGCACCACCCACACCTGGG + Intronic
1068418857 10:56762937-56762959 CAAAGACACCACTCAAAGGTGGG - Intergenic
1068945472 10:62724728-62724750 CAGAGGCCCAACCCAGAGATTGG - Intergenic
1069156629 10:65037824-65037846 CAAAGGCACCACTCAAAGGTGGG - Intergenic
1070420612 10:76232920-76232942 CAAAGACACCACTCAAAGGTGGG + Intronic
1071337929 10:84616904-84616926 CAGAGCCACCACAGAGAGCTAGG + Intergenic
1072199322 10:93144509-93144531 CAAAAACACCACTCAAAGGTGGG - Intergenic
1073331518 10:102673022-102673044 CAGAAGTAGCACTCAGAGGCTGG + Intergenic
1073903527 10:108250429-108250451 CAAAGACACCATTCAAAGGTTGG - Intergenic
1073931743 10:108584682-108584704 CAAAAGCACCACTCAAAGGTGGG - Intergenic
1075003361 10:118813811-118813833 CAGAGGCTTTACTGAGAGGTTGG - Intergenic
1075992315 10:126848480-126848502 ACCAGGCCCCACTCAGAGGTGGG + Intergenic
1076121767 10:127941901-127941923 CAGAGCCACCAGTGAGAAGTTGG + Intronic
1080125522 11:28729263-28729285 CAAAGGCATCATTCAAAGGTGGG - Intergenic
1080445730 11:32335292-32335314 CAAAGACACCACTCAAAGGTGGG + Intergenic
1081650893 11:44823505-44823527 TAAAGACACCACTCAAAGGTGGG + Intronic
1083096220 11:60254213-60254235 CAAAGGCAACACTCAAAGGTGGG - Intergenic
1083106239 11:60361061-60361083 CAAAGACACCACTCAAAAGTGGG + Intronic
1083668257 11:64286652-64286674 CAGAAGCACCAGCCAGAGCTGGG - Exonic
1083839741 11:65297440-65297462 GAGAGGCACCACTCAGAGGCAGG - Exonic
1085468138 11:76738086-76738108 TAGACGCACCACTCAGAGGGTGG - Intergenic
1085516163 11:77113076-77113098 CAGAGGCAGCACTCACATTTAGG + Intronic
1087597479 11:100272659-100272681 CAGAGGGAAAACACAGAGGTTGG + Intronic
1088027297 11:105200933-105200955 CATATGCACCAGTCTGAGGTTGG - Intergenic
1090150047 11:124374445-124374467 CAAAGACACCATTCAAAGGTGGG + Intergenic
1090293536 11:125567135-125567157 CAAAGGCACCACTCAAAGGTGGG + Intergenic
1093592360 12:20917838-20917860 TGAAGGCACCACTCAAAGGTGGG + Intergenic
1094742874 12:33310029-33310051 CAAAGGCAACACTGAAAGGTGGG - Intergenic
1094780101 12:33781333-33781355 CAAAGACACCACTCAAAGGTGGG - Intergenic
1095307129 12:40651620-40651642 CAAAGGCAGCACTCAAAGGTGGG + Intergenic
1095756317 12:45770735-45770757 CAGAGGCACCACTCAGAGGTGGG + Intronic
1095889276 12:47220748-47220770 TAGAGGCATCCCTCAGAGGAAGG + Intronic
1096321050 12:50613104-50613126 GAGAGGCAGCACTGAGAGGTAGG + Intronic
1096464250 12:51839452-51839474 CAGAGGCAGAATTCAGAGGTGGG - Intergenic
1096581863 12:52590852-52590874 CAGAGGATCCGCTCAGAGATAGG - Exonic
1096964705 12:55616832-55616854 AAGAGGCATCACTCAAAGGTGGG - Intergenic
1098702458 12:73645986-73646008 AAAAGGCACCACTCAAAGATGGG + Intergenic
1099767014 12:86999464-86999486 CAGAGGAACCCCTCAAATGTGGG - Intergenic
1099831044 12:87843054-87843076 GAGTGGCACCAATCTGAGGTTGG - Intergenic
1099938192 12:89153223-89153245 CAAAGACACCACTCAAAGGTGGG + Intergenic
1100263478 12:92954231-92954253 CAAAGACACCACTCAAAGGTGGG + Intergenic
1101662941 12:106782677-106782699 CAGAGGGAAGACTCAGAGGTAGG - Intronic
1101762347 12:107669262-107669284 AAGAGGCACCACAAAGAGTTGGG - Intergenic
1104219332 12:126766955-126766977 CAAAGGTAGCACTCAAAGGTGGG - Intergenic
1105479072 13:20756808-20756830 TGAAGGCACCACTCAAAGGTGGG - Intronic
1106629175 13:31452625-31452647 CAAAGGCACCACTCAAAGGTGGG - Intergenic
1106933933 13:34697239-34697261 CAAAGACACCACTCAAAGGTGGG + Intergenic
1107760090 13:43669058-43669080 AAGATGCACTACTCAGAAGTCGG + Intronic
1107823231 13:44305008-44305030 CAAAGACATCACTCAAAGGTGGG + Intergenic
1108358713 13:49650768-49650790 CAGAGGCACCCAGCAGGGGTGGG + Intergenic
1109074823 13:57821467-57821489 TAAAGGCACCACTCAAAGGTGGG + Intergenic
1109123545 13:58488705-58488727 CAAAGACACCACTCAAAGGTGGG - Intergenic
1109492870 13:63126587-63126609 CAAAGGCACCACTCAAAAGTGGG - Intergenic
1109510680 13:63368040-63368062 CAAAAGCACCACTGAAAGGTGGG + Intergenic
1109685333 13:65812637-65812659 CAAAGACACCACTCCAAGGTGGG - Intergenic
1110057102 13:70986894-70986916 CAAAGGCACCACTTAAAGGTGGG - Intergenic
1110935594 13:81283986-81284008 CAAAGACACTACTCAAAGGTGGG - Intergenic
1111213340 13:85109150-85109172 CAAAGGCACCACTCAGAGGTGGG + Intergenic
1111213500 13:85111230-85111252 CAAAGGCACCACTGAAAGGTGGG + Intergenic
1111310005 13:86472143-86472165 CAAAGCCACCACTCAAAGGTGGG + Intergenic
1111423800 13:88052634-88052656 CAAAGGCACCACTCAAAGGTGGG + Intergenic
1112227438 13:97553573-97553595 CTGATCCACCACTCAGAAGTGGG + Intergenic
1113504674 13:110807018-110807040 CCAAGGCACCACTGAGAGTTTGG - Intergenic
1113991313 14:16029977-16029999 GAGAGACTCCACTCAGAGGAGGG - Intergenic
1114843387 14:26291950-26291972 CAGTGGGACCTATCAGAGGTTGG - Intergenic
1115193291 14:30769867-30769889 CAGAGGCACCAGTCAGGAGCTGG + Intergenic
1116003885 14:39272022-39272044 CAAAGACACCACTTAGAGGTGGG + Intronic
1116355557 14:43924578-43924600 CAAAGACACCACTCAAAGGTGGG - Intergenic
1116525580 14:45900216-45900238 CAGAGGTGCCACTCAGGGGCAGG + Intergenic
1117108711 14:52426258-52426280 CACAGGCACCTTACAGAGGTGGG + Intergenic
1118648002 14:67858551-67858573 CAAAGACACCACTCAAAGGTGGG + Intronic
1120442340 14:84557088-84557110 CAAAGGCACCAGTCAAAGGTGGG + Intergenic
1120578513 14:86216058-86216080 CTGAGGGACTTCTCAGAGGTTGG + Intergenic
1120942134 14:89958574-89958596 CAAAGGCACCACTCAAAGGTGGG + Intronic
1121054715 14:90843237-90843259 CTCAGGCAGCACTGAGAGGTGGG + Intergenic
1121145958 14:91582625-91582647 CAAAGGTACCACTCAAAGGTGGG - Intronic
1121594084 14:95146359-95146381 TAAAAGCACCACTCAAAGGTGGG - Intronic
1122688161 14:103519646-103519668 GAGAGGCACCACTCAGACGCAGG + Exonic
1123016390 14:105377549-105377571 CAGAGGCCCCAGTCAGAGTCAGG + Intronic
1123457494 15:20439255-20439277 TAGTGCCATCACTCAGAGGTGGG - Intergenic
1123457507 15:20439317-20439339 CAGTGCCGTCACTCAGAGGTGGG - Intergenic
1123457521 15:20439379-20439401 TAGTGCCATCACTCAGAGGTGGG - Intergenic
1123457534 15:20439441-20439463 CAGTGCCGTCACTCAGAGGTGGG - Intergenic
1123660537 15:22560980-22561002 CAGTGCCGTCACTCAGAGGTGGG + Intergenic
1123660550 15:22561042-22561064 CAGTGCCGTCACTCAGAGGTGGG + Intergenic
1123660564 15:22561104-22561126 CAGTGCCGTCACTCAGAGGTGGG + Intergenic
1124054390 15:26228401-26228423 CAAAGACACAACTCAAAGGTGGG + Intergenic
1124263665 15:28214528-28214550 CAGTGCCGTCACTCAGAGGTGGG - Intronic
1124821719 15:33052854-33052876 TAAAGACACCACTCAAAGGTGGG - Intronic
1128466750 15:67918949-67918971 CGAAGGTACCACTCAAAGGTGGG + Intergenic
1128809588 15:70561180-70561202 CAGATGCACCAATCAGAGCATGG - Intergenic
1128863230 15:71092289-71092311 CAGCGGCGCCACTCTGAGGGTGG + Intergenic
1129277139 15:74453432-74453454 GACAGGCACCACTGAGAGGGAGG + Intronic
1129340529 15:74882933-74882955 CAAAGGCATCACTCAAAGGTGGG + Intergenic
1129964726 15:79724065-79724087 CAGAGGCAGCACTCAGACACTGG - Intergenic
1130352367 15:83104181-83104203 CAGAGGCAGGAATCAGAGGGAGG + Intergenic
1132641100 16:978995-979017 CAAAAGCACCTCTCAGAGGCGGG - Intronic
1134064931 16:11221982-11222004 CAGAGGCACCACCCAGACTGAGG - Intergenic
1135521941 16:23184266-23184288 CAGAGGTACCCCTGAGAGCTGGG + Intronic
1136248783 16:28990098-28990120 CAGAGGGACAAGCCAGAGGTAGG - Intronic
1136701982 16:32152715-32152737 CAGTGCCATCACTCAGAGGTCGG - Intergenic
1136701994 16:32152777-32152799 CAGTGCCATCACTCAGAGGTGGG - Intergenic
1136765672 16:32774683-32774705 CAGTGCCATCACTCAGAGGTGGG + Intergenic
1136765683 16:32774745-32774767 CAGTGCCATCACTCAGAGGTCGG + Intergenic
1136802415 16:33095633-33095655 CAGTGCCATCACTCAGAGGTCGG - Intergenic
1136802427 16:33095695-33095717 CAGTGCCATCACTCAGAGGTGGG - Intergenic
1136910491 16:34141101-34141123 GAGAGACTCCACTCAGAGGAGGG - Intergenic
1137976092 16:53033393-53033415 CAAAGACACCACTCAAAGGTGGG - Intergenic
1138152356 16:54670395-54670417 CAAAGACACCATTCAAAGGTGGG + Intergenic
1139291701 16:65864337-65864359 CAAAGGCACCACTCAAATGTGGG - Intergenic
1139682460 16:68575564-68575586 CAAAGGCACTACTCAAAGGTGGG + Intronic
1142079870 16:88143337-88143359 AGGAGGCACCACTCAGAGCGGGG + Intergenic
1142204178 16:88774911-88774933 CAGAGGAACCAGTCAAAGGAAGG + Intronic
1142317472 16:89357140-89357162 TAGGGGCACTGCTCAGAGGTAGG + Intronic
1203068060 16_KI270728v1_random:1036931-1036953 CAGTGCCATCACTCAGAGGTGGG + Intergenic
1203068072 16_KI270728v1_random:1036993-1037015 CAGTGCCATCACTCAGAGGTCGG + Intergenic
1142913809 17:3117153-3117175 GAGAGACACCACAGAGAGGTGGG - Intergenic
1142946411 17:3433065-3433087 CAGTGACACCACAGAGAGGTGGG + Exonic
1143888363 17:10083805-10083827 CAAAGACACCACGCAGAAGTGGG + Intronic
1144865492 17:18332861-18332883 CTGAGGCTCAACTGAGAGGTTGG - Intronic
1145824940 17:27869812-27869834 CAAAAACACCACTCAAAGGTGGG - Intronic
1146651939 17:34612462-34612484 CAGAGCCCCCACTCAGAGGTAGG + Intronic
1146837743 17:36125855-36125877 CAAAGGCACCACTCAAAGGTGGG + Intergenic
1148428138 17:47618498-47618520 CAGAGACACTTCTCAGAGATGGG - Intronic
1148627072 17:49077788-49077810 CAAAGGCATCACTCAGAGGTGGG - Intergenic
1150463864 17:65375272-65375294 CAGGTGCACCAGTAAGAGGTGGG + Intergenic
1150625843 17:66840591-66840613 CAGAGGCACATGTCAGAGGCAGG + Intronic
1150626066 17:66841947-66841969 CAGAGGCACCACTGAGCAGATGG + Intronic
1150737158 17:67750854-67750876 CAAAGGCACCACTCAAAGGTGGG - Intergenic
1151401408 17:73858186-73858208 TGGAGTCACCACTCAGAGCTTGG + Intergenic
1151635863 17:75347413-75347435 CAAAGGCACCACTCAAAGATGGG - Intronic
1152597238 17:81243784-81243806 CAGGGGCACCACTCAGCATTTGG - Intergenic
1154156062 18:11945182-11945204 CAAAGACACCACTCAAAGGTGGG - Intergenic
1154283261 18:13027390-13027412 CAGAGGATCCAGTCATAGGTGGG - Intronic
1154428878 18:14293292-14293314 CTGAGGCTGCACACAGAGGTGGG - Intergenic
1155819829 18:30361682-30361704 CAAAGGCACCTCTCAAAGGTGGG - Intergenic
1156163332 18:34386726-34386748 TAAAGACACCACTCAAAGGTGGG - Intergenic
1156775629 18:40784668-40784690 CAGAGGAACCAGCCAGAGTTGGG - Intergenic
1157909065 18:51597974-51597996 AAAAGGCATCACTCAAAGGTGGG + Intergenic
1158018365 18:52810669-52810691 CAAAGATACCACTCAAAGGTGGG + Intronic
1159207133 18:65267175-65267197 CAGGGGCACCACTCAGATGAGGG - Intergenic
1159431868 18:68362752-68362774 CAAAGGCATCACTCAAAGGTGGG - Intergenic
1161395379 19:4042645-4042667 CAGAGACCCTACCCAGAGGTAGG + Intergenic
1161682735 19:5688020-5688042 CAGAGACACCCCTGAGAGGGTGG + Exonic
1162466297 19:10843146-10843168 CGAAGACACCACTCAAAGGTGGG + Intronic
1164968581 19:32509983-32510005 CAGAGGGATCACTCAGAAGTGGG + Intergenic
1165000552 19:32758341-32758363 CAAACACACCACTCAAAGGTGGG + Intronic
1165123358 19:33577712-33577734 CAGAGGCCTCAGACAGAGGTGGG - Intergenic
1165638528 19:37364249-37364271 CAAAGGCACCACTCAAAAGGTGG - Exonic
1165872129 19:38980516-38980538 CAAAGGCACCATTCAAAGATGGG - Intergenic
1166099119 19:40560504-40560526 CAGAGGCGCCACACAGATATTGG - Intronic
925376578 2:3389962-3389984 CAAAGTCACCACTCAAAGGTGGG + Intronic
925801869 2:7609654-7609676 GAGGGGAACCACTCTGAGGTGGG - Intergenic
926955459 2:18290499-18290521 CAGAGTCACCACACAGACTTGGG - Intronic
927955035 2:27201972-27201994 CAGATGCATCACTCACAGGAGGG + Exonic
928459655 2:31458487-31458509 CAAAGACACCACTCAAAGGTGGG + Intergenic
928537935 2:32258174-32258196 CAGAGGAACGACTCGGAGTTTGG - Intronic
928941412 2:36730915-36730937 CAAAGACACCACTCAAAGGTGGG + Intronic
930014277 2:46959707-46959729 CAGAGGCACATTTCAGAGGAAGG - Intronic
930118949 2:47744159-47744181 GAAAGACACCACTCAAAGGTGGG - Intronic
930556205 2:52898856-52898878 CAAAGGCACCACTCAAAGGCAGG - Intergenic
930677945 2:54224503-54224525 CAAAGACACCACTCAAAGGTGGG + Intronic
930818386 2:55621410-55621432 CAACAGCACCACTCAAAGGTAGG - Intergenic
930991073 2:57655325-57655347 CAAAGGCACCACTCAAAGGTGGG + Intergenic
931102277 2:59015552-59015574 CAAAGGCACCACTCAAAGGTGGG + Intergenic
932726989 2:74188137-74188159 CAAAGGCACCACTCAAAGGTGGG - Intergenic
932869278 2:75380854-75380876 TAAAGACACCACTCAAAGGTGGG - Intergenic
932873355 2:75425717-75425739 TAAAGGCACCACTCAAAGGTGGG + Intergenic
933056696 2:77679555-77679577 CAAAGACACCACTCAAAGGTGGG + Intergenic
933557764 2:83851563-83851585 TAAAGGCATCACTCAAAGGTGGG + Intergenic
933926828 2:87100697-87100719 CAAAGACACCACTCAAAGGTGGG + Intergenic
933978089 2:87528032-87528054 CAGAGGCACTGGTCAGAGGGTGG + Intergenic
936078337 2:109415858-109415880 CAGGCGCAGCACTGAGAGGTGGG + Intronic
936315746 2:111422771-111422793 CAGAGGCACTGGTCAGAGGGTGG - Intergenic
936555932 2:113498991-113499013 AAGTGGCACCGCTCCGAGGTAGG + Exonic
937837198 2:126483371-126483393 CAAAGGCACCACTCAAAGATGGG + Intergenic
938568978 2:132544907-132544929 CAAAGGCACCACTCAAAGGTGGG + Intronic
938691269 2:133791737-133791759 AGGAGGCACCAATCAGAGATGGG + Intergenic
938839409 2:135144425-135144447 CAAAGGCACCACTCAAAGGGGGG + Intronic
939060820 2:137419605-137419627 CAAAGGCACCACTCAAAGGTGGG + Intronic
939113364 2:138033431-138033453 CAAAGGCACCACTGAAAGGTGGG - Intergenic
939393146 2:141594047-141594069 CAAAGACACCACTCAAAGGTGGG - Intronic
939393910 2:141604637-141604659 CGAAGGCACCACTCAAAAGTGGG - Intronic
940367191 2:152861287-152861309 CAGAGGCACCTCTAAGATTTGGG + Intergenic
940569837 2:155417170-155417192 CAAAAGCACCACTCAAAGGTGGG + Intergenic
940878538 2:158922552-158922574 AAAAGGCACCACTCAGAGATGGG + Intergenic
941928447 2:170917972-170917994 CAAAGGCACCACTCAAAGACGGG + Intergenic
941978439 2:171430908-171430930 CAAAGGCACCACTCAAAGGTGGG - Intronic
943375284 2:187068751-187068773 CAAAGACAGCACTCAAAGGTGGG + Intergenic
943483704 2:188454378-188454400 CAAAGGCACCACTCAAAGGTGGG + Intronic
945369773 2:209002996-209003018 CAAAGAAACCACTCAAAGGTGGG - Intergenic
945491166 2:210457069-210457091 CAGAGGCCCAAATGAGAGGTAGG - Intronic
945545439 2:211144774-211144796 CAAAGGCTCCACTCAAAGGTTGG - Intergenic
947053554 2:226074973-226074995 CAAAGACACCACTCAAAGGTGGG - Intergenic
947772523 2:232681922-232681944 CAGAGGCAGGAGACAGAGGTGGG - Exonic
948432747 2:237930439-237930461 CAAAGGCACTGCTCAAAGGTGGG - Intergenic
948504098 2:238416221-238416243 CAAAGGCACAATTCAAAGGTGGG + Intergenic
948645762 2:239402846-239402868 GTGAGGCACCACGCAGACGTTGG + Intergenic
949004895 2:241639775-241639797 CAAAGTCACTACTCAAAGGTGGG + Intronic
1169273423 20:4217621-4217643 CAGAGGCGCGGCTCAGAGGCAGG + Intergenic
1170746569 20:19104487-19104509 CAGAGGCTCCACCCAGTGGTGGG + Intergenic
1171266670 20:23776661-23776683 CAGAGGCATCAGTGAGAGCTTGG + Intergenic
1171813277 20:29762508-29762530 GAGAGACTCCACTCAGAGGAGGG + Intergenic
1171905954 20:30899809-30899831 GAGAGACTCCACTCAGAGGAGGG - Intergenic
1172363586 20:34332197-34332219 CAAAGACATCACTCAAAGGTGGG - Intergenic
1172502490 20:35437258-35437280 CAGGGGCACGGCTCAGAGGGAGG - Intronic
1172552267 20:35810399-35810421 CAAAGGCGTCACTCAAAGGTGGG - Intronic
1173531009 20:43769535-43769557 CAGAGGCCCCACACAGAGCCAGG - Intergenic
1174115856 20:48225945-48225967 CAGAAGCCCCAGTCAGAGGAAGG + Intergenic
1176192358 20:63818056-63818078 CAGTGCCACCACTCAGAGCGTGG - Intronic
1177773100 21:25539143-25539165 CAAAGGCACCATTCAAAGGTGGG - Intergenic
1177900897 21:26913942-26913964 CAAAAACACCACTCAAAGGTGGG - Intergenic
1177967380 21:27744709-27744731 CAAACACACCACTCAAAGGTGGG + Intergenic
1178103501 21:29295422-29295444 CAAAGACACCACTCAAAGGCAGG - Intronic
1178170402 21:30033924-30033946 CAAAGGCACCACTCAAAGATGGG + Intergenic
1178467410 21:32860363-32860385 CAAAAGCACCACTCAAAGGTGGG + Intergenic
1178530041 21:33368540-33368562 CAAAGACACCACTGAAAGGTGGG - Intergenic
1178638832 21:34329730-34329752 CAGGGGCACCAAGCAGATGTAGG - Intergenic
1179140451 21:38720479-38720501 ACGAGGCTCCACTCAGAGGCAGG - Intergenic
1180315955 22:11277547-11277569 GAGAGACTCCACTCAGAGGAGGG + Intergenic
1180339377 22:11605929-11605951 GAGAGACTCCACTCAGAGGAGGG - Intergenic
1182229673 22:28828033-28828055 CAGTGGCACAACTGAGGGGTTGG - Intergenic
1182777978 22:32845151-32845173 CAGAAGCACCAATCAGAGAAGGG - Intronic
1182867721 22:33618909-33618931 CAAAGACACCACACAAAGGTGGG - Intronic
1183177772 22:36237126-36237148 CAGAGGCTCCAGACAAAGGTGGG - Intronic
1183601051 22:38840842-38840864 CAGAGGCAGCAGACAGAGGGAGG + Intronic
1183768350 22:39900340-39900362 AAGTGGCACCATTCAGAGTTTGG - Intergenic
1184313250 22:43662448-43662470 CAGAGGCTGCACTTAGATGTTGG - Intronic
1184576091 22:45367475-45367497 CAGCAACACCACACAGAGGTAGG - Intronic
1184837968 22:47035296-47035318 CAGAGGCAGCGCACAGTGGTGGG + Intronic
1184870262 22:47233314-47233336 CAAAGGCAACATTCAAAGGTGGG - Intergenic
1185051828 22:48558001-48558023 CAGAGGCCCCAGTCTGAGGGGGG + Intronic
1185075037 22:48678427-48678449 CAGAGGAACCAGGAAGAGGTCGG + Intronic
949371675 3:3341433-3341455 CAGAGGAAGCACTCAGAGTGGGG - Intergenic
949474577 3:4431354-4431376 CAAAGACACCACTCAAAGGTGGG - Intronic
949996189 3:9619284-9619306 AAAAGGCACCACTCAAAGATGGG - Intergenic
950979586 3:17288546-17288568 CAAAGGCACCACTTAGAGGTGGG - Intronic
951396005 3:22167268-22167290 CAAAGGCATCACTCAAAGGTGGG - Intronic
951822110 3:26825263-26825285 CAAAGACACCACTCAAAGGTGGG - Intergenic
953007131 3:38988964-38988986 CTTTGGCACCACTGAGAGGTGGG + Intergenic
953146926 3:40286169-40286191 GGGTGGCACCAGTCAGAGGTTGG - Intergenic
954237073 3:49265104-49265126 CAGAAGTACCACTCTGAGGCTGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955534112 3:59904899-59904921 CAAAGACACCACTCAAAGGTGGG + Intronic
955934518 3:64089927-64089949 CAAAGACATCACTCAAAGGTGGG - Intergenic
956521365 3:70107764-70107786 CAGAATCACCTTTCAGAGGTTGG - Intergenic
956558193 3:70544056-70544078 CAAAAGCACCAATCAGAGGCAGG + Intergenic
956863833 3:73350404-73350426 CACATGCACCACCCAGAAGTAGG + Intergenic
958170014 3:89927691-89927713 CAAAGACACCACTCAAAGGTGGG - Intergenic
958540553 3:95465193-95465215 CAAAGACACCACTCAAAGGTGGG + Intergenic
958758122 3:98274641-98274663 TAAAGTCACCACTCAAAGGTGGG - Intergenic
959693557 3:109224901-109224923 CAAAGACACCACTCAAAGATGGG + Intergenic
962308796 3:134311686-134311708 CAGAAGGCCCACCCAGAGGTGGG + Intergenic
962665439 3:137649543-137649565 CTGAGGCATAGCTCAGAGGTAGG + Intergenic
962880594 3:139572959-139572981 CAGAAGCACCATGCAGCGGTGGG - Intronic
963251024 3:143103759-143103781 TGAAGGCACCACTCAAAGGTGGG - Intergenic
964133302 3:153315125-153315147 CAAAGACACCACTCAAAGATGGG + Intergenic
967184525 3:186933184-186933206 CAAAGACACCACTCAAAGGTGGG - Intronic
967839264 3:193991639-193991661 CAGACCAACCACTCAGAGGAGGG - Intergenic
968561695 4:1286642-1286664 CAAAGGCATCACTCAAAGGTGGG + Intergenic
968666386 4:1824604-1824626 GAAAGGCACCACCGAGAGGTGGG + Intronic
970726156 4:19047212-19047234 CAGAGGGAGCAATCAGAGCTGGG - Intergenic
971001860 4:22332545-22332567 CAAAGACACCACTCCAAGGTGGG - Intergenic
971109861 4:23572914-23572936 TAGAGACACCACTCAAAGGTGGG + Intergenic
972176939 4:36419784-36419806 CAAAGGCACCACTCAAAGGTGGG - Intergenic
973063672 4:45761898-45761920 AAAAGGCACCGCTCAAAGGTGGG + Intergenic
973136074 4:46708613-46708635 CAAAGGCACCACTGGAAGGTGGG - Intergenic
974456792 4:62138968-62138990 CAAAGACACCACTCAAAGGTGGG + Intergenic
979067354 4:116155243-116155265 GAGAGGCACCAGTCTGAGGCTGG + Intergenic
980081596 4:128350457-128350479 CAAAGACACCACTCAAAGGTGGG - Intergenic
980481546 4:133394805-133394827 CAAAGTCACCACACAAAGGTGGG - Intergenic
980729112 4:136804486-136804508 CAAAGATACCACTCAAAGGTGGG - Intergenic
981078360 4:140613947-140613969 CAAAGGGAGAACTCAGAGGTTGG - Intergenic
981538501 4:145824645-145824667 CAGAGGCACTGGTGAGAGGTAGG - Intronic
982064224 4:151638672-151638694 CAGAGACACCACACAAAGCTGGG - Exonic
982607131 4:157528904-157528926 TGAAGGCACCACTCAAAGGTGGG + Intergenic
983333332 4:166359521-166359543 CAAAGGCACCACTCAAAGGTAGG + Intergenic
983351958 4:166601817-166601839 AAAAGGCACCACTCAGAAGTGGG - Intergenic
983472442 4:168173859-168173881 AAAAGGCACCACTCAAAGATGGG - Intronic
984400436 4:179257308-179257330 CAAAGACACTACTCAAAGGTGGG + Intergenic
985101241 4:186460515-186460537 CAAAGACATCACTCAAAGGTGGG + Intronic
986895901 5:12367968-12367990 CACAGGAACAACTCAAAGGTGGG + Intergenic
987431258 5:17836342-17836364 CAGTGGGACCTCTCACAGGTAGG - Intergenic
987486414 5:18532794-18532816 CGAAGACACCACTCAAAGGTGGG - Intergenic
987576324 5:19733316-19733338 CAAAGGCACCAGTCAAAGGTGGG - Intronic
988088811 5:26508278-26508300 CAAAGGCACCACTCAAAGGTGGG - Intergenic
988361297 5:30239718-30239740 CAAAGGCACCACTCAAAGGTGGG - Intergenic
988681629 5:33489429-33489451 AAAAGGCACCACTCAAAGATGGG + Intergenic
989585428 5:43070917-43070939 CAAAAGCACCACTCAAAGGTGGG - Intronic
990527344 5:56640958-56640980 TAGAAGCACCACTCAGGGCTAGG + Intergenic
991356928 5:65778411-65778433 CACAGGCACCACTGAGATATGGG + Intronic
992231655 5:74670208-74670230 CAAAGGCACCACTCACAGGTGGG - Intronic
992927932 5:81609801-81609823 CAAAGACACCACTGAAAGGTGGG - Intronic
993219260 5:85069762-85069784 CAAAGGCAACACCCAAAGGTGGG - Intergenic
993937987 5:94026571-94026593 CAAAAGTACCACTCAAAGGTGGG + Intronic
995320702 5:110830566-110830588 CAAAGACACCACTCAAAGGTGGG - Intergenic
996423036 5:123283247-123283269 TAGCGGCACGAGTCAGAGGTGGG - Intergenic
998300856 5:141018431-141018453 GAGAGGCACCATTAAGAGTTTGG + Intergenic
1000057317 5:157618849-157618871 CAAAGACACCACTCAAAGGTGGG + Intergenic
1002709929 5:181189273-181189295 CAGGGGCAGGACACAGAGGTTGG + Intergenic
1004983283 6:21050631-21050653 CAAAGACACCACTCAAAGGTGGG + Intronic
1006765813 6:36505417-36505439 CTGAGGCCCCACTGATAGGTGGG + Intronic
1007778834 6:44239527-44239549 CAGAGAGACCAGTCAGGGGTGGG - Intergenic
1008035906 6:46744965-46744987 AAGAAGCACCACTGAGAGGTAGG - Intergenic
1008248069 6:49203592-49203614 CAAAGACACCAATCAAAGGTGGG - Intergenic
1009523284 6:64711908-64711930 CAAAGACACCACTCAAAGTTGGG + Intronic
1010294589 6:74181753-74181775 TAAAGACACCACTCAAAGGTGGG + Intergenic
1010372109 6:75122370-75122392 CAAACGTACCACTCAGATGTGGG + Intronic
1011748682 6:90433785-90433807 CAAAGGCACCACTCAAAGGTGGG - Intergenic
1012399106 6:98830352-98830374 AAGAAGTTCCACTCAGAGGTTGG + Intergenic
1014916863 6:127161120-127161142 CAGAGGAAACAATAAGAGGTGGG - Intronic
1015353665 6:132252046-132252068 TAAAGGCACCACTCAAAAGTGGG - Intergenic
1015554444 6:134446414-134446436 CAAAGGCACCAATGAGACGTAGG - Intergenic
1015897853 6:138034458-138034480 CAGAGGCACCACTGAGCCGGTGG - Intergenic
1016162742 6:140901646-140901668 CAAAGGCACCACTCAAAGGTGGG + Intergenic
1016702483 6:147069366-147069388 CAAAGGCACCACTCAAAGATGGG - Intergenic
1016730465 6:147422607-147422629 CAAAGGCACCACTCAAAGATGGG - Intergenic
1017939714 6:159041038-159041060 CAGAGGCACCATCCCCAGGTGGG + Intronic
1018529526 6:164747949-164747971 CAAAGGTACCACTCAAAGGTGGG + Intergenic
1019348184 7:540705-540727 CACAGGGAACACTCAGATGTTGG - Intergenic
1019368352 7:647025-647047 CAAAGGGGCCACCCAGAGGTGGG + Intronic
1021115763 7:16744857-16744879 CAAAGGCAATACTCAAAGGTGGG + Intergenic
1021147031 7:17101657-17101679 CAAAGGCATCACTCAAAGGTGGG + Intergenic
1021813544 7:24426176-24426198 CAAAGGCACCACTCTAAGGTGGG + Intergenic
1022497562 7:30862572-30862594 CGGAGGCAGCAGGCAGAGGTGGG - Intronic
1022721795 7:32948266-32948288 CAAAAGCACCCCTCAAAGGTGGG - Intergenic
1022980687 7:35602178-35602200 CAAAGGCACCACTCAAAGGTAGG + Intergenic
1024395350 7:48859975-48859997 CAGAGCCATGACACAGAGGTTGG + Intergenic
1025062561 7:55823249-55823271 CAAAGGCACCACCCAAAGGTGGG - Intronic
1025552702 7:62270348-62270370 CAGATACACCAATCAGACGTAGG + Intergenic
1025618203 7:63142863-63142885 CAAAGGCACCACCCAAAGGTGGG - Intergenic
1027632319 7:80622019-80622041 CAAAGACACCACTCAAAGGTGGG - Intronic
1027672535 7:81119238-81119260 CAAAGGCACCACTCAAAGGTGGG + Intergenic
1027746615 7:82082496-82082518 CAAAGGCACTTCTCAAAGGTGGG + Intronic
1027769768 7:82392196-82392218 CAAAGGCATCATTCAAAGGTTGG - Intronic
1028000738 7:85494770-85494792 CAAAGACACCACTCAAAGGTGGG + Intergenic
1028020756 7:85768295-85768317 CAAAGGCACCACTCAAAGGTGGG - Intergenic
1028177012 7:87671636-87671658 CAAAGGCACCTGTAAGAGGTGGG + Intronic
1028999631 7:97139422-97139444 CAAAGGCACCACTCAAAAGTAGG + Intronic
1030249641 7:107428028-107428050 CCAAGGCACCACTCAAAGGTGGG + Intronic
1030384245 7:108848452-108848474 CAAAGACACCACTCAAAGGTGGG + Intergenic
1030593473 7:111508688-111508710 CAAAGACACCACTCAAAGGTGGG + Intronic
1031173966 7:118325395-118325417 AAAAGGCACCACTCAAATGTGGG + Intergenic
1032726382 7:134593214-134593236 CAGAGGCAGAAATCAGAGGGAGG - Intergenic
1033089447 7:138371615-138371637 CAGAGGCTCCAAACAGAGATTGG + Intergenic
1033928223 7:146489911-146489933 CAAAAGCACCACTTAAAGGTGGG + Intronic
1034419689 7:150983014-150983036 CAGAGGAACCACTCATGGGTGGG - Intergenic
1034717344 7:153255872-153255894 CAAAGGCACCACTCAAAGGTGGG - Intergenic
1035087297 7:156271486-156271508 AAAAGGCACCACTCAAAGATGGG + Intergenic
1035298946 7:157884651-157884673 CAGAGGCACATCTCACAGGGTGG + Intronic
1035335061 7:158122610-158122632 CTGAGGCCCCACACAGCGGTGGG + Intronic
1036423348 8:8618590-8618612 CTGGGCCACCACTCAGAGCTTGG - Intergenic
1036641745 8:10589076-10589098 CAAATGCACCACTCTGGGGTGGG + Intergenic
1037301941 8:17461079-17461101 CAAAGACACCACTCAAAAGTGGG + Intergenic
1037425012 8:18746199-18746221 CAAAAACACCACTCAAAGGTGGG - Intronic
1037473028 8:19229261-19229283 CAAAGGCACCAGTAAAAGGTGGG + Intergenic
1038520324 8:28226836-28226858 CAAGGGCACCACTCAAAGGTGGG - Intergenic
1038547346 8:28435663-28435685 CAAAGACACCATTCAAAGGTGGG + Intronic
1038562985 8:28596580-28596602 CGAAGACACCACTCAAAGGTGGG + Intergenic
1038664147 8:29522903-29522925 CAGAGGCACCGCTCAGGGCCTGG - Intergenic
1038871153 8:31495167-31495189 CAAAGACACCACTCAGACGTGGG + Intergenic
1039072025 8:33657507-33657529 AAAAGGCACCACTCAAAGATGGG - Intergenic
1039494951 8:37973692-37973714 CGAAGACACCACTCAAAGGTGGG + Intergenic
1040541619 8:48362158-48362180 CAGGGAAACCACTCAGAGGGGGG + Intergenic
1041151996 8:54944547-54944569 CAAAGGCACCATTCAAAGATGGG + Intergenic
1041983793 8:63895045-63895067 CGAAGACACCAGTCAGAGGTGGG + Intergenic
1042194527 8:66221092-66221114 AAGAGGCACAACTCAGACCTCGG - Intergenic
1042664700 8:71192467-71192489 AACAGGCAGCACACAGAGGTGGG + Intergenic
1043687529 8:83106714-83106736 CAAAGACAACACTCAAAGGTGGG - Intergenic
1043891146 8:85654193-85654215 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043892222 8:85661030-85661052 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043893341 8:85716310-85716332 TAGAGGCACCACAGGGAGGTGGG + Intergenic
1043896024 8:85737759-85737781 TAGAGGCACCACAGGGAGGTGGG + Intergenic
1043896655 8:85744049-85744071 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043898978 8:85762416-85762438 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043900589 8:85774610-85774632 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043902553 8:85789885-85789907 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043904163 8:85802078-85802100 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043905775 8:85814272-85814294 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1043907383 8:85826459-85826481 TAGAGGCACCACAGGGAGGTGGG - Intergenic
1044414837 8:91925946-91925968 CAAAGGCACCACTCAAAGGTAGG - Intergenic
1048301165 8:133252488-133252510 CAGAGGCTCCACTCTGGAGTTGG - Intronic
1048301185 8:133252568-133252590 CAGAGGCCCCACTCCGGAGTTGG - Intronic
1048301194 8:133252608-133252630 CAGAGGCCCCACTCCGGAGTTGG - Intronic
1048301202 8:133252648-133252670 CAGAGGCCCCACTCTGGAGTTGG - Intronic
1048410673 8:134169032-134169054 TAAAGGCAGCACTCAAAGGTTGG + Intergenic
1049358873 8:142202400-142202422 CAGGGGCCCCGCTCAGAGGTGGG - Intergenic
1049610060 8:143550733-143550755 CAAAGGCACCACTGAAAGGTGGG - Intergenic
1049634849 8:143682181-143682203 CAAAGGCACCACTGAAAGGTGGG + Intergenic
1049897092 9:118363-118385 AAGTGGCACCGCTCCGAGGTAGG - Intergenic
1050016280 9:1237422-1237444 CGAAGACACCACTCAAAGGTGGG + Intergenic
1050718760 9:8561194-8561216 CGAAGACACCACTCAAAGGTGGG - Intronic
1050931367 9:11331009-11331031 CAAAGACACCACTCAAAGGTGGG + Intergenic
1050939682 9:11443161-11443183 CAAAGACACCACTCAAAAGTCGG - Intergenic
1051996147 9:23220070-23220092 CAAAGACACCACTCAAAGGTGGG + Intergenic
1052640982 9:31165605-31165627 CAGAGACAACACTAAGAGGGAGG - Intergenic
1053357914 9:37462531-37462553 CAAAGACACCACTCAAAGGTGGG - Intronic
1053740192 9:41128627-41128649 AAGTGGCACCGCTCCGAGGTAGG - Intergenic
1054443157 9:65284621-65284643 AAGTGGCACCGCTCCGAGGTGGG - Exonic
1054487123 9:65736880-65736902 AAGTGGCACCGCTCCGAGGTAGG + Exonic
1054688156 9:68302686-68302708 AAGTGGCACCGCTCCGAGGTAGG + Intergenic
1056633603 9:88313864-88313886 TACATGCAGCACTCAGAGGTGGG - Intergenic
1056760258 9:89409447-89409469 CAAAGGCACCACTCTGTGGGGGG + Intronic
1056896921 9:90559669-90559691 CAGAGGCCCCACCCAGAGCAGGG + Intergenic
1056923093 9:90809328-90809350 CAGCAGCATCACTCAGTGGTTGG - Intronic
1057010540 9:91597600-91597622 CAGATGCACCACTGTGAGGGGGG - Intronic
1057209153 9:93190230-93190252 CAGAAGCACCACTGAGAGCTTGG - Intronic
1057316040 9:93969127-93969149 CAGAGGCCTCACCAAGAGGTGGG + Intergenic
1060312709 9:122477177-122477199 GATAGTCACCACTGAGAGGTGGG + Exonic
1060486885 9:124053398-124053420 CAAAGACACCACTCAAAGGTGGG - Intergenic
1060982924 9:127803807-127803829 CAGAGGAGCAACTCAGAGGGAGG - Intronic
1061044184 9:128155624-128155646 CAAAGGCACCACTCAAAGGTGGG - Intergenic
1061730579 9:132610928-132610950 CAGAGGGACCACCCAGTGGAGGG - Intronic
1062159282 9:135070751-135070773 CAGAGGCTCCATGTAGAGGTGGG - Intergenic
1203364252 Un_KI270442v1:243501-243523 GAGAGACTCCACTCAGAGGAGGG + Intergenic
1186820701 X:13285069-13285091 CAAAGGCACCAATCAAAGGTGGG - Intergenic
1188201849 X:27301034-27301056 CAGATACACCAATCAAAGGTAGG - Intergenic
1189134106 X:38531715-38531737 CAGAAGCACAAGTCACAGGTAGG + Intronic
1189201961 X:39204174-39204196 CAGATGTTCCACTCAGAGGCTGG - Intergenic
1189515685 X:41711706-41711728 CGAAGACACCACTCAAAGGTGGG - Intronic
1189644317 X:43110216-43110238 CAGTGAGACAACTCAGAGGTTGG + Intergenic
1189971380 X:46421281-46421303 CAAAGACACCACTCAAAGATGGG - Intergenic
1190487468 X:50942140-50942162 TAAAGGTACCACTCAAAGGTGGG + Intergenic
1190705570 X:53024086-53024108 CGAAGACACCACTCAAAGGTGGG - Intergenic
1191594628 X:62929440-62929462 CAAAGGTGCCACTCAAAGGTGGG + Intergenic
1191595265 X:62936547-62936569 CAAAGGCACCACTCAAAGGTGGG + Intergenic
1193807566 X:86013018-86013040 CAAAGGCACCACTCAAAGTTGGG - Intronic
1194227643 X:91280495-91280517 CAAAGATACCACTCAAAGGTGGG + Intergenic
1194932771 X:99908158-99908180 CAGAGGCAGCAGTCACAGGAGGG + Intergenic
1195146103 X:102018762-102018784 CAAAGTTACCACTCAAAGGTGGG + Intergenic
1195569910 X:106386252-106386274 CAGAGGCACCACCCAGAAAAGGG + Intergenic
1197396315 X:125931938-125931960 CAAAGACACCATTCAAAGGTGGG + Intergenic
1198046954 X:132912963-132912985 CAAGGGCACCACTCAAAGGTGGG - Intronic