ID: 1095758578

View in Genome Browser
Species Human (GRCh38)
Location 12:45800401-45800423
Sequence TTCTCCAGTACTGAGAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095758578 Original CRISPR TTCTCCAGTACTGAGAAATC TGG (reversed) Intronic
901779908 1:11587045-11587067 TTCTCCAGCACTGATAGACCTGG - Intergenic
902946141 1:19841041-19841063 TTCTCCAGTAGTGAAGAATTAGG - Intergenic
903044982 1:20557760-20557782 TTCTCCACTCCTGCCAAATCTGG + Intergenic
904605730 1:31696614-31696636 TTCTCCAGAACAGAGATACCTGG - Intronic
904668182 1:32140641-32140663 TTCTTGAGAACTGAGAAATGGGG + Intronic
905083948 1:35352779-35352801 TACTTCAGTATTTAGAAATCTGG - Intronic
905183639 1:36180897-36180919 TTCTTCAGTTCTTAGAACTCAGG - Intergenic
905498675 1:38418427-38418449 TTCTCTAGCAGTGAGAAACCTGG + Intergenic
907870926 1:58442009-58442031 TTCTCCTTCACTGAGAAATGGGG - Intronic
909261463 1:73494620-73494642 ATTTCCAGTAATCAGAAATCTGG + Intergenic
911944211 1:104085324-104085346 TTTACCAGTTCTGAGAAATTGGG - Intergenic
912601686 1:110941395-110941417 TTCTCCAACAGTGAGAAACCTGG + Intergenic
913367621 1:118058653-118058675 TTCTCCTGTAGCAAGAAATCTGG - Intronic
913514536 1:119592367-119592389 TTCTCCATTGCTTAGAAATATGG + Intergenic
915027827 1:152849453-152849475 TACTCCAATATTGAGAAATCAGG + Intergenic
915042515 1:152981035-152981057 TTCTGCAAGGCTGAGAAATCTGG + Intergenic
915535175 1:156531017-156531039 CTCACCAGTAATGAGAACTCTGG - Intronic
916918910 1:169440378-169440400 TTCTCCTGTCTTGATAAATCAGG - Intronic
920141919 1:203822173-203822195 TTCTCCAGAAGTGAGAAACTTGG + Intronic
920164728 1:204027896-204027918 TTCCCAAGTACAGAGCAATCTGG - Intergenic
921634373 1:217475628-217475650 TGCTCCAATACTGAAAAATTAGG + Intronic
922027490 1:221764239-221764261 TACTCCAATAGTGAGAAACCTGG - Intergenic
923203855 1:231739282-231739304 TTCTCCAATAATCAGGAATCTGG + Intronic
923593538 1:235341516-235341538 TTCTCAACCACTCAGAAATCTGG - Intronic
923902197 1:238338342-238338364 TTCTTCAGTAGTGAGAAACCTGG + Intergenic
924095798 1:240549592-240549614 TTCCACAGAACTGAGACATCTGG + Intronic
1062925399 10:1312512-1312534 CACTCCAGAAATGAGAAATCAGG - Intronic
1063666753 10:8065768-8065790 ATCTCCAGTGCTCAGATATCCGG - Intronic
1064432693 10:15284793-15284815 TTCTCTAGTCCTGGGAAATGTGG + Intronic
1066993807 10:42543305-42543327 TTCTCCAATAGTGAGAAACCAGG - Intergenic
1067018755 10:42776862-42776884 CTCTCCAACAGTGAGAAATCTGG + Intergenic
1067392349 10:45875352-45875374 ACCTCCAGGACAGAGAAATCAGG - Intergenic
1067463063 10:46472329-46472351 TTCTCCATGAGTGAGAAAACTGG - Intergenic
1067624130 10:47912309-47912331 TTCTCCATGAGTGAGAAAACTGG + Intergenic
1067870936 10:49960709-49960731 ACCTCCAGGACAGAGAAATCAGG + Intronic
1068478578 10:57560667-57560689 TTCTCCAGTAAAGACAAACCTGG - Intergenic
1070014773 10:72515587-72515609 TTCTCCAAAAATGAGAAACCTGG + Intronic
1070364675 10:75725169-75725191 TTCTCCAGTTCCCAAAAATCTGG - Intronic
1071143525 10:82540715-82540737 TTCTCCAATAGTGAGAAAACTGG - Intronic
1072226809 10:93377826-93377848 TTCTCCAACAGTGAGAAATCTGG - Intronic
1074652427 10:115539455-115539477 TTCACCAGTACTTTGAATTCTGG - Intronic
1074778570 10:116784365-116784387 CTCTGCAGAACAGAGAAATCAGG - Intergenic
1075237254 10:120742037-120742059 TTCCCCTGTAGTGAAAAATCAGG - Intergenic
1076154545 10:128193548-128193570 TTCCCTAGTACTGAGACATGGGG + Intergenic
1076310038 10:129499043-129499065 TTCTCCAACATTGAGAAACCTGG + Intronic
1076498775 10:130917808-130917830 CACTCCAGTATTGAAAAATCAGG + Intergenic
1077426923 11:2484902-2484924 TTCTTCAATAGTGAGAAACCTGG + Intronic
1077991069 11:7412956-7412978 TGCTCAAGTACTGAGAAGACAGG + Intronic
1078081737 11:8209169-8209191 TTCTCCAGTCCTCAGAATTTTGG + Intergenic
1078189739 11:9083500-9083522 TTCTCCAACAGTGAGAAATCTGG - Intronic
1079044214 11:17085475-17085497 ATCTACAGAACTGAGAAATGTGG - Intronic
1080467927 11:32515603-32515625 TTCTCCAACAGTGAGAAACCTGG - Intergenic
1080757342 11:35214834-35214856 GTCTCCTGTAATGAGCAATCAGG - Exonic
1083375393 11:62216200-62216222 TTCTCCAGTCTTGATAAACCAGG + Intergenic
1083514374 11:63243037-63243059 TTTTCCAGTCCAGAGAAAGCAGG + Intronic
1087348758 11:97004442-97004464 CTCTACAGTACTGAGGAAGCTGG + Intergenic
1088043017 11:105411621-105411643 TTCTGCAGTATTTAGAATTCTGG - Intergenic
1088124406 11:106406021-106406043 TTCTCTGACACTGAGAAATCTGG + Intergenic
1088477393 11:110256614-110256636 TTCTCCAGTGCTGAGATTACAGG - Intronic
1088987241 11:114920067-114920089 TTCTCCAGGACTCAGAAGGCTGG + Intergenic
1090633757 11:128674905-128674927 TTCCCCAAGAGTGAGAAATCTGG - Intergenic
1091101861 11:132881865-132881887 TTCTCCAGATCTGGGAAATGTGG + Intronic
1091322137 11:134659056-134659078 TTCTTCACTGCAGAGAAATCTGG - Intergenic
1091788487 12:3257420-3257442 CTTTCCAGGACTGTGAAATCTGG + Intronic
1094382847 12:29862275-29862297 TTCTCCATCACTGGGAAATATGG - Intergenic
1095758578 12:45800401-45800423 TTCTCCAGTACTGAGAAATCTGG - Intronic
1096726676 12:53569500-53569522 TTTGCAAGTACTGAGAATTCTGG - Intronic
1100479201 12:94961530-94961552 TTGTACAATACTGAGAAGTCAGG + Intronic
1101155043 12:101919216-101919238 GTTTCCAGCACTGAAAAATCAGG + Intronic
1101520882 12:105481142-105481164 TTCTGCTGTACTGATAAATCAGG - Intergenic
1101623101 12:106409509-106409531 CTCTCTATTACTGAGAACTCTGG - Intronic
1101922919 12:108947514-108947536 TTCTCCAATAATGGGAAATTTGG + Intronic
1102054655 12:109887523-109887545 TTCTCCTGCAGTGAGAAACCTGG + Intergenic
1106327620 13:28709389-28709411 TTCTCCAGTATTGACTAAACTGG + Intronic
1106822200 13:33477741-33477763 TTCCCCATGACTGAGAAATGAGG + Intergenic
1108312559 13:49210361-49210383 TTCATCAGTACTGGGAAGTCTGG - Intergenic
1109821008 13:67654488-67654510 ATCTCTAGTACTGAAAAATACGG - Intergenic
1109952762 13:69522017-69522039 TTCTCCAGTAACTATAAATCTGG - Intergenic
1110100148 13:71590422-71590444 TTCTTCAGAATTGAGAAATTTGG - Intronic
1110268697 13:73568843-73568865 TTCTCCAGATCTTACAAATCTGG - Intergenic
1111730442 13:92069749-92069771 TTATCCAGAACTGCCAAATCTGG + Intronic
1111887721 13:94043669-94043691 TTCTCCAACAATGAGAAATCCGG + Intronic
1115066712 14:29270993-29271015 TTCTTGAGTACATAGAAATCTGG - Intergenic
1115673594 14:35644657-35644679 TGCTCCAGCAATGAAAAATCTGG - Intronic
1116020247 14:39452024-39452046 TTCTCCAATAGTGAGAAACTTGG - Intergenic
1116184741 14:41583583-41583605 TTCTTCAGTGCTGGGAAAACTGG - Intergenic
1116539317 14:46079330-46079352 TTCTCAAGCAATGAGAAACCTGG + Intergenic
1118272378 14:64355459-64355481 TTAGTCAGTACTGAGAAATAAGG + Intergenic
1122216853 14:100210374-100210396 TTATCAATTACTGAGAACTCAGG + Intergenic
1122582928 14:102782613-102782635 TTCTCAAGAACTGAAAAATTGGG + Intronic
1124690781 15:31820713-31820735 TTCTCCAGGAATTTGAAATCAGG + Intronic
1124969983 15:34478548-34478570 TTCTCAAGCACTGAAAAATATGG + Intergenic
1125033559 15:35097162-35097184 TTCCCTAGCACTGAGAAAACAGG - Intergenic
1126119806 15:45241571-45241593 TTCGCCAGGGATGAGAAATCAGG - Intergenic
1126722802 15:51600029-51600051 TTCTTCAATAATGAGAAACCTGG + Intronic
1127316071 15:57795167-57795189 TTCTCAAGCACTGAGAAAGCAGG - Intergenic
1128198541 15:65783319-65783341 CTCTCCAAAAGTGAGAAATCTGG - Intronic
1130385699 15:83409673-83409695 CTCTTCAGCAGTGAGAAATCTGG + Intergenic
1130545857 15:84857396-84857418 TGCTCCCGTGCTGAGAAGTCGGG - Exonic
1131586466 15:93700645-93700667 TTCAACAGGACTGACAAATCAGG - Intergenic
1132109851 15:99094731-99094753 TTCTCCAGCAGTGAGAAGCCTGG - Intergenic
1132189338 15:99837208-99837230 TTCTCAAGCACTGAAAAATATGG - Intergenic
1134365085 16:13569782-13569804 TTCAGTACTACTGAGAAATCTGG - Intergenic
1135083335 16:19454835-19454857 TTCTCATGTACTGAGAAGTGTGG + Intronic
1138653668 16:58477002-58477024 TTCTCCAGTGGTGAGAAACCTGG - Intronic
1138757596 16:59507184-59507206 TTCTCCTACACTGAGAAACCTGG - Intergenic
1140026963 16:71299454-71299476 CACTCCAGTATTAAGAAATCAGG - Intergenic
1140260957 16:73379187-73379209 TCCTCCATGACTAAGAAATCAGG - Intergenic
1140453041 16:75087001-75087023 TGGTCCTGTCCTGAGAAATCAGG + Intronic
1146299512 17:31677266-31677288 TGCTCAAGTTCTGAGAAAACGGG - Intergenic
1147642342 17:42011074-42011096 TTCTCCAGCACTGAGTGATGTGG - Intronic
1148066709 17:44876335-44876357 TTCTTTAGCACTGAGAAACCTGG - Intronic
1148801371 17:50228673-50228695 TTCTCCAACAATGAGAAACCTGG + Intergenic
1149643929 17:58225492-58225514 TTCTCCACTACAAAGGAATCAGG + Intronic
1149801010 17:59567362-59567384 TTTTCATCTACTGAGAAATCAGG + Intronic
1150176266 17:63060081-63060103 TTCTTCCACACTGAGAAATCTGG + Intronic
1152914453 17:83026188-83026210 TTCTCCAGCACTTAGAATTCCGG - Intronic
1153131080 18:1856296-1856318 TTCTCCAATAGTCAAAAATCAGG - Intergenic
1153515439 18:5896344-5896366 TTCTCCAGGAATCAGGAATCAGG + Intergenic
1153605729 18:6829359-6829381 TTCTCCAATAGTGATAAACCTGG + Intronic
1155484873 18:26330775-26330797 TTCTCCAGTCTTGAGAAACTTGG + Intronic
1155947382 18:31870690-31870712 TTCTTTAGTACAGAGAAATTGGG - Intronic
1158765675 18:60447373-60447395 TTCTCCAGTCCTGGGAATTCCGG - Intergenic
1159930714 18:74310535-74310557 TTGTCCAGTACAGAGAAAGTGGG - Intergenic
1160119495 18:76116029-76116051 TTCTCCGACACTGAGAAATCTGG + Intergenic
1160285773 18:77541816-77541838 ATCACCAGGAATGAGAAATCAGG - Intergenic
1164113927 19:22198011-22198033 TTCTTCAGCACTGAGAGAGCAGG + Intergenic
1164689319 19:30197967-30197989 TTTTCCAACAGTGAGAAATCTGG - Intergenic
1164820419 19:31246481-31246503 TTCTCCAACAATGAGAAACCTGG - Intergenic
1167215861 19:48164280-48164302 TTCTCCCGTGATGAGGAATCTGG - Intronic
1202633094 1_KI270706v1_random:17927-17949 CTCTCCTGTATTCAGAAATCAGG - Intergenic
1202652785 1_KI270707v1_random:22123-22145 CTCTCCTGTATTCAGAAATCAGG + Intergenic
928246499 2:29633191-29633213 ATTTCCAGGAATGAGAAATCAGG - Intronic
928953874 2:36841133-36841155 TTCTACAGCAATGAGAAATAAGG + Intergenic
930263524 2:49173725-49173747 TTCTCCAGAACTGAGGAAGTTGG + Intergenic
930955682 2:57199575-57199597 TTCTCCAGGACTTAGTAACCTGG + Intergenic
931004788 2:57836530-57836552 TTCTCGAACATTGAGAAATCTGG - Intergenic
931320357 2:61169755-61169777 TTGTCTAATAATGAGAAATCTGG + Intergenic
931696941 2:64878280-64878302 ATCTATAGTTCTGAGAAATCAGG - Intergenic
932214174 2:69955591-69955613 TTCTCTAATAATGAGAAACCTGG - Intergenic
932444478 2:71767498-71767520 CTCGCCATTTCTGAGAAATCAGG - Intergenic
933048082 2:77564302-77564324 ATCTCCAACAATGAGAAATCTGG - Intronic
933363412 2:81316606-81316628 ATGTCCAGTACAGAAAAATCTGG + Intergenic
933834364 2:86233196-86233218 TTCTCATGTACTGAGAAAAATGG - Intronic
933917227 2:87007911-87007933 TTTTCTAGTAGTGAGAAACCTGG - Intronic
934005769 2:87762003-87762025 TTTTCTAGTAGTGAGAAACCTGG + Intronic
934874377 2:97902404-97902426 TTCTCCAACAATGAGAAATCTGG - Intronic
935754526 2:106266539-106266561 TTCTCCAGCTGTGAGAAACCTGG - Intergenic
935768724 2:106396109-106396131 TTTTCTAGTAGTGAGAAACCTGG + Intronic
935841136 2:107111827-107111849 TTCTTCAATGGTGAGAAATCTGG - Intergenic
935911376 2:107899819-107899841 TTTTCTAGTAGTGAGAAACCTGG - Intergenic
935969492 2:108516659-108516681 TTTTCTAGTAGTGAGAAACCTGG - Intergenic
936133159 2:109864880-109864902 TTTTCTAGTAGTGAGAAACCTGG - Intergenic
936211538 2:110506605-110506627 TTTTCTAGTAGTGAGAAACCTGG + Intergenic
936420676 2:112361180-112361202 TTTTCTAGTAGTGAGAAACCTGG + Intergenic
937763717 2:125635044-125635066 GTATCCAGTACTAAGAAATTGGG - Intergenic
939656709 2:144835293-144835315 TTCTTCAGAACTGTGAAATGAGG - Intergenic
939749031 2:146017880-146017902 TTATCCAGAGCTGGGAAATCTGG + Intergenic
941178580 2:162231767-162231789 TTGTCTAGTACTGAAAAATTAGG + Intronic
942466214 2:176209822-176209844 TTTGGCAGTAGTGAGAAATCTGG - Intergenic
944479272 2:200138721-200138743 TTTTCCAGTCCTGAGAAGTTAGG + Intergenic
945171183 2:206996784-206996806 TTGTGCAGTACTGAGAACACTGG + Intergenic
946318853 2:218936532-218936554 TTCTCCAATAGTGAGAAACCTGG - Intergenic
947274719 2:228377477-228377499 TTCTCCAGCACTGAGAAATGGGG - Intergenic
947451349 2:230211826-230211848 CTCTCCAGTACTGAGAAGAGGGG - Intronic
947513543 2:230781441-230781463 TTCTACAGTGCTCAGAAATTTGG + Intronic
948163223 2:235842149-235842171 TGCTCCAGAACTAAGAAACCAGG - Intronic
1170119901 20:12900452-12900474 TTCCCTAGTACTGTGAAATCAGG - Intergenic
1170188060 20:13614906-13614928 TTCTCCAGTACTACCAAATTTGG + Intronic
1170851098 20:20005222-20005244 TTCCCCAGCAGTGAGAAATGAGG - Intergenic
1173896586 20:46555572-46555594 GACCCCAGTGCTGAGAAATCAGG - Intergenic
1175659535 20:60800507-60800529 CACTCCAGCAGTGAGAAATCTGG - Intergenic
1176599367 21:8777530-8777552 CTCTCCTGTATTCAGAAATCAGG - Intergenic
1176645315 21:9343807-9343829 CTCTCCTGTATTCAGAAATCAGG - Intergenic
1177337186 21:19745014-19745036 TTCTTCATCAGTGAGAAATCTGG - Intergenic
1177735498 21:25083974-25083996 TTATCCACTACTGAGAAAGGTGG + Intergenic
1177812728 21:25941943-25941965 TTGTCCTGCACTGAAAAATCTGG + Intronic
1178926481 21:36779492-36779514 TTCTCCAATAGTGGGAAATCTGG + Intronic
1180367637 22:11955427-11955449 CTCTCCTGTATTCAGAAATCAGG + Intergenic
1180378450 22:12115907-12115929 CTCTCCTGTATTCAGAAATCAGG - Intergenic
1180419060 22:12797372-12797394 CTCTCCTGTATTCAGAAATCAGG + Intergenic
1181304327 22:21906196-21906218 ATCTCCAGCAGTGAGAAACCTGG + Intergenic
1182884480 22:33761584-33761606 ATCTCCAGTGCTAAGAACTCAGG - Intronic
1184207904 22:43016713-43016735 TTCTCCAGGACTGAGCCAACAGG + Intergenic
1184241792 22:43214861-43214883 TTCTCCAGCACTGAGAAACTCGG - Intronic
949452384 3:4200573-4200595 TTCTCTAGTTCTGAGACCTCTGG + Intronic
951123227 3:18952848-18952870 TTCTCCAATAGTGAAAAATTTGG + Intergenic
953125512 3:40088399-40088421 CTCTCCATTACTGGGAAACCAGG + Intronic
955272438 3:57515016-57515038 TTCTCTATTAGTGAGGAATCTGG - Intronic
955616688 3:60815750-60815772 TTTTCCAGTTCTGTGAAATATGG + Intronic
956443699 3:69305169-69305191 TTCTCCAGTACTGAAAGTCCCGG - Intronic
956494184 3:69806589-69806611 AACTCCAGTACTAAGAACTCAGG + Intronic
957095010 3:75770235-75770257 TTCTCCTGTATTCAGAAATCAGG + Intronic
959608800 3:108270982-108271004 TTTTACAGTACTGAAAAGTCAGG - Intergenic
962790791 3:138809638-138809660 TACTCCAATAGTGAAAAATCTGG - Intronic
963190145 3:142461569-142461591 TTCTCCAATAGTGAGAAAACTGG + Intronic
963701046 3:148627155-148627177 GTCTTCAGTAATGAGAAGTCAGG + Intergenic
964078071 3:152716238-152716260 TTTTCCAGAGGTGAGAAATCTGG + Intergenic
964081398 3:152763006-152763028 TTCTACATCACTGAGAATTCAGG - Intergenic
964116428 3:153140510-153140532 ATGTACAGTACTGAGAACTCTGG - Intergenic
965835828 3:172851501-172851523 TTCTCCAGCAGTGAGAAACCTGG - Intergenic
966714702 3:183003592-183003614 TTCTCAAGTAGTCAGAAATTAGG - Intergenic
967398249 3:189030944-189030966 TTCTCCAGTAATAAGTAATAGGG - Intronic
968228162 3:196988949-196988971 TTCTACAGGACTGGGAAATGAGG - Intronic
1202741575 3_GL000221v1_random:61261-61283 CTCTCCTGTATTCAGAAATCAGG + Intergenic
972268860 4:37489797-37489819 TTTTCCAGCACAGATAAATCTGG + Intronic
973398370 4:49616952-49616974 CTCTCCTGTATTCAGAAATCAGG + Intergenic
974069157 4:57109132-57109154 TTCTTCAATACTAAGAAATCAGG + Intronic
974525101 4:63040959-63040981 TTCTCCAACAGTGAGAAATATGG + Intergenic
975514919 4:75236438-75236460 TTCTCTGAGACTGAGAAATCTGG - Intergenic
975896091 4:79092906-79092928 TTCTCCAACAGTGAGAAATCTGG + Intergenic
976878668 4:89890398-89890420 TTCTCCAGTACCCAGAAATGAGG + Intronic
979005750 4:115295053-115295075 TTCTCCAGTACTCATATATTTGG + Intergenic
979782769 4:124675262-124675284 TTCACCAGTACTGCGTAATGCGG - Intronic
980866335 4:138557174-138557196 TTCTCCAATAATGAGAAACCAGG - Intergenic
982670855 4:158318797-158318819 TTCTCCAGTGCTGAGAGCTGTGG + Intronic
982719029 4:158840200-158840222 TTATCCAGTACAGGGAAAGCAGG + Intronic
983055973 4:163099306-163099328 TGCTTCAGTTCTGAGATATCAGG + Intergenic
983808888 4:172031949-172031971 TTCTCCAGCACTGAAAGATGGGG - Intronic
983885241 4:172974340-172974362 TGCTCCAACACTGAGAAATGGGG - Intronic
1202760070 4_GL000008v2_random:101373-101395 CTCTCCTGTATTCAGAAATCAGG - Intergenic
986231722 5:5870325-5870347 TTCCTCAGTTCTGATAAATCAGG + Intergenic
987266952 5:16265842-16265864 TGCTCCAATACTGGGAAATCAGG - Intergenic
987718869 5:21609321-21609343 TTCTCCAGCAGTGAGAAGCCTGG - Intergenic
988714068 5:33807313-33807335 CTCTCCTGTATTTAGAAATCTGG - Intronic
989532158 5:42520518-42520540 TTTTCCAGTCCTGAGAAATTTGG - Intronic
990723204 5:58722312-58722334 TTTTCCCCTACTGAGAAATTAGG + Intronic
991358101 5:65790935-65790957 TTCTTTTGTACTGAGAGATCTGG + Intronic
992142443 5:73812644-73812666 TTCTCCAGTAATTAGCATTCAGG - Intronic
993027728 5:82665545-82665567 TTCTCCATTACTGACAAAACAGG + Intergenic
993276400 5:85865280-85865302 TTTAACAGCACTGAGAAATCTGG - Intergenic
997884214 5:137615995-137616017 TTCTCCTGTAAGGAGAAACCAGG + Intergenic
998519469 5:142786577-142786599 TTCTCCATAACTGAGATATCAGG - Intronic
999055541 5:148571712-148571734 GCATCCAGTACTGATAAATCAGG - Intronic
999361673 5:150991196-150991218 TTCTCCAGTCTTGATAAACCAGG - Intergenic
1000618213 5:163453971-163453993 TTCTCAAGGTTTGAGAAATCTGG + Exonic
1000769343 5:165332960-165332982 ATCTACAATACTGAGAAACCTGG - Intergenic
1000810425 5:165854682-165854704 TTTTGAAGTACTGAGAAATGTGG - Intergenic
1001763511 5:174226481-174226503 TGCTGCAGTAATGAGGAATCAGG + Intronic
1007135010 6:39512401-39512423 TTCTCCAGTCCTGTAAGATCTGG + Intronic
1008288678 6:49685540-49685562 TTCTCTAATAGTGAGAAACCTGG + Intergenic
1009884552 6:69610313-69610335 TACTCCAGCAGTGAGAAAGCAGG - Intergenic
1010478045 6:76313758-76313780 TTCTACAGAAGTCAGAAATCTGG - Intergenic
1011124001 6:83986816-83986838 TGCTCCAGTCATGAGAAATAAGG + Intergenic
1012095908 6:94960319-94960341 TTTTCCTTTACTGATAAATCTGG - Intergenic
1015006905 6:128293827-128293849 TTCTCTAGTACAGACAATTCAGG + Intronic
1015129974 6:129798308-129798330 TTCTCCAACAGTGAGAATTCTGG + Intergenic
1015281839 6:131442682-131442704 ATCTCCAGCACTGAGATTTCAGG - Intergenic
1015309640 6:131752282-131752304 TTCTCCAATAGTGAGAAATTTGG + Intergenic
1016403590 6:143706528-143706550 CTCTCCAGTAGTGAGAAACCTGG + Intronic
1017603607 6:156109969-156109991 ATCTGCAGTACGGAGAAGTCAGG - Intergenic
1018768050 6:166949622-166949644 TTCTCCAGCACTGAGCAGTAAGG - Intronic
1019378987 7:711808-711830 TTCTGCAGTTCTGAGGATTCCGG + Intronic
1019462166 7:1166025-1166047 TTCTCCAGCAGTGAGAAACCTGG + Intergenic
1020567213 7:9812575-9812597 TCCTCCAGTACTGAGAACAATGG + Intergenic
1021542066 7:21770780-21770802 ATTTCCAGTTCTGAAAAATCTGG - Intronic
1022223924 7:28343387-28343409 TTCTCCATTTCTGTGAGATCAGG + Intronic
1022477210 7:30719298-30719320 TTCTCAAGTCTTGATAAATCAGG - Intronic
1023974125 7:45015265-45015287 TTTTCCAACAGTGAGAAATCTGG + Intronic
1026156405 7:67829609-67829631 TTCTGCAGTACCTATAAATCTGG + Intergenic
1028116844 7:87007336-87007358 TTCTCCAACAATGAGAAACCTGG - Intronic
1028833557 7:95350221-95350243 TTTTCCAATAATGGGAAATCAGG - Intergenic
1028956773 7:96702133-96702155 TTCTCCAATAGTGAGAAACCTGG - Intronic
1030361271 7:108597687-108597709 ATTTCCACTACTGAGAAAGCTGG - Intergenic
1030428459 7:109410484-109410506 TGCTCAAGAAATGAGAAATCTGG - Intergenic
1030435564 7:109514908-109514930 TCCTTCAGCACTGAGAAACCTGG + Intergenic
1030929970 7:115510528-115510550 TTCTCCAACAGTGAGAAAACTGG - Intergenic
1032243809 7:130189635-130189657 TTCTCCAGTAGTGAAAAACCAGG - Intronic
1032317886 7:130856607-130856629 TCCTCTAGTGCTGAGATATCTGG + Intergenic
1032557013 7:132846967-132846989 TTCTCGTGTAATAAGAAATCTGG + Intronic
1032832328 7:135640896-135640918 TTCTCCTGTATTCAGAAATTTGG + Intronic
1035491739 7:159285088-159285110 TTCTGTAGTTCTGAGGAATCCGG + Intergenic
1036489601 8:9212606-9212628 TCCTCCAGGAAGGAGAAATCAGG - Intergenic
1038345188 8:26725930-26725952 TTCATCAGTACTGAGAGATGAGG + Intergenic
1038909740 8:31949638-31949660 TGCTCCAGTAATGAGAAATTAGG - Intronic
1039391157 8:37181655-37181677 TTCTCCATTAGTGGGAAAACAGG + Intergenic
1041693165 8:60709918-60709940 TACTCCATTACTAACAAATCAGG - Intronic
1043203821 8:77409960-77409982 TTCTCCAGTCTTCAGAAAGCAGG - Intergenic
1043858179 8:85285916-85285938 TTCTCCAACAGTGAGAAACCTGG + Intergenic
1044575879 8:93768713-93768735 TTCTCCAGGGGTGAGGAATCTGG + Intronic
1046325545 8:112640058-112640080 TTCTCCAATACTTGAAAATCTGG + Intronic
1050677527 9:8072773-8072795 TTCCCCAGTTTTGAGCAATCAGG + Intergenic
1051741549 9:20257456-20257478 TTCTGCAGTACTAATGAATCTGG - Intergenic
1052266187 9:26576488-26576510 TTCTACAGCACTCTGAAATCTGG + Intergenic
1052802386 9:32981267-32981289 TTCTCCAACAGTGAGAAACCTGG - Intronic
1055100137 9:72455689-72455711 TTCCCCAGAACTAAGAAATGAGG - Intergenic
1055978828 9:81980724-81980746 TTCTCCAACAATGAGAAATCTGG + Intergenic
1056449154 9:86698603-86698625 TTCTCCAATGATGAGAAGTCTGG + Intergenic
1056540834 9:87569583-87569605 TTCTCCAGCAGTGAGAACTTAGG - Intronic
1056686536 9:88768233-88768255 TCCTCCAATAGTGAGAAATCTGG + Intergenic
1057610391 9:96537582-96537604 TTCTCCAGTAGTGATAAAGATGG - Intronic
1058569093 9:106321591-106321613 TTCTCTCCTACAGAGAAATCAGG + Intergenic
1061776162 9:132966099-132966121 CTCTCAAGTGCTGAGAAAGCAGG - Intronic
1203691852 Un_GL000214v1:49589-49611 CTCTCCTGTATTCAGAAATCAGG - Intergenic
1203710209 Un_KI270742v1:91185-91207 CTCTCCTGTATTCAGAAATCAGG + Intergenic
1203644443 Un_KI270751v1:54602-54624 CTCTCCTGTATTCAGAAATCAGG + Intergenic
1189907961 X:45781330-45781352 TTCTCAATTACTGAGAGCTCAGG - Intergenic
1189913289 X:45832671-45832693 TTCCCCAGAACTGAGTAAACGGG - Intergenic
1191136967 X:57075141-57075163 TTCTCCAGCAGTGAGAAACCTGG + Intergenic
1195535735 X:106007434-106007456 TGCTACAGTACTGAGAACTTTGG - Intergenic
1198425107 X:136510585-136510607 TTCTGCAGTACTGTGATATTTGG + Intronic
1198826905 X:140708109-140708131 TTCTCCTATAGTGAGAACTCTGG + Intergenic
1199828425 X:151523923-151523945 TTCTGAAGTAATGATAAATCAGG + Intergenic
1200553869 Y:4611467-4611489 TTCTCCAGCACTTCGAAATTAGG + Intergenic
1201327817 Y:12783856-12783878 GTCTCCAGGAGTGAGAAACCTGG + Intronic
1201923576 Y:19260802-19260824 TTTTCCAATAATGGGAAATCAGG + Intergenic
1201954250 Y:19605000-19605022 TTTCCCAGTACTTAGAAATATGG + Intergenic