ID: 1095762334

View in Genome Browser
Species Human (GRCh38)
Location 12:45853744-45853766
Sequence CTGCTGACACAGTTCTGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095762329_1095762334 14 Left 1095762329 12:45853707-45853729 CCTACATAGCCAGAACCTTCTAT 0: 1
1: 0
2: 2
3: 11
4: 149
Right 1095762334 12:45853744-45853766 CTGCTGACACAGTTCTGGCTTGG 0: 1
1: 0
2: 0
3: 21
4: 184
1095762328_1095762334 21 Left 1095762328 12:45853700-45853722 CCTAATTCCTACATAGCCAGAAC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1095762334 12:45853744-45853766 CTGCTGACACAGTTCTGGCTTGG 0: 1
1: 0
2: 0
3: 21
4: 184
1095762330_1095762334 5 Left 1095762330 12:45853716-45853738 CCAGAACCTTCTATGACTACTGC 0: 1
1: 0
2: 0
3: 11
4: 93
Right 1095762334 12:45853744-45853766 CTGCTGACACAGTTCTGGCTTGG 0: 1
1: 0
2: 0
3: 21
4: 184
1095762331_1095762334 -1 Left 1095762331 12:45853722-45853744 CCTTCTATGACTACTGCCAACTC 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1095762334 12:45853744-45853766 CTGCTGACACAGTTCTGGCTTGG 0: 1
1: 0
2: 0
3: 21
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095762334 Original CRISPR CTGCTGACACAGTTCTGGCT TGG Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
901256305 1:7830133-7830155 CTGCTGAACCAGTTCTGGATGGG - Exonic
902282501 1:15384658-15384680 ACGCTGACACAGGTTTGGCTTGG - Intronic
903021878 1:20400496-20400518 CTTCTGACACAGTGGTGCCTGGG + Intergenic
906145002 1:43554762-43554784 CTGATGAATCAGTTGTGGCTGGG - Intronic
906665850 1:47621522-47621544 CTGGTGACACACTTCACGCTGGG - Intergenic
906849381 1:49231514-49231536 TTGCTGAGACAGATCTTGCTTGG - Intronic
908406112 1:63815829-63815851 CTACTGACACAGTCCTGGGGTGG + Intronic
910514531 1:88045259-88045281 CTCCTTAGACAGTTCTGGGTGGG - Intergenic
916576654 1:166072940-166072962 CTGCTCACACAGCTCTGGGCAGG - Intronic
917810877 1:178657372-178657394 CTGTTGACTCAGTTTGGGCTGGG + Intergenic
920868481 1:209773138-209773160 CTACTTACCCATTTCTGGCTTGG + Intronic
921963591 1:221062997-221063019 CTTCTGACACAGTCCTGGCAGGG - Intergenic
922979825 1:229816298-229816320 CAGCTGACAAGGTTCTGGCTGGG + Intergenic
923948467 1:238919572-238919594 CTCCTGACACAGTTCTTGGCAGG + Intergenic
924442704 1:244099730-244099752 CTGCTGTCACTGTCCTGGCATGG + Intergenic
924551354 1:245080931-245080953 CTGCTGACACATTGGCGGCTAGG - Intronic
1063922443 10:10945831-10945853 ATGTTGACAAATTTCTGGCTGGG + Intergenic
1064055613 10:12094660-12094682 AAGCTGACACAGTTCTGGGCTGG + Intronic
1064463295 10:15555613-15555635 CAGCAGTCACAGTCCTGGCTGGG - Intronic
1065849006 10:29771240-29771262 CTGCTGATCCAGTTCTCACTGGG - Intergenic
1069689289 10:70339294-70339316 CAGCAGACACAATTCTGGCTAGG + Intronic
1071541603 10:86489922-86489944 CTTAAGACACAGTTTTGGCTTGG + Intronic
1071964189 10:90835454-90835476 CTGATGACCCAGTTCTGCCTTGG - Intronic
1075206800 10:120456051-120456073 CTGCTCACACAATTTTGGCTGGG + Intergenic
1079013418 11:16848079-16848101 CTGCTGCCACTATTCTGTCTTGG - Intronic
1080763673 11:35276483-35276505 CTGCTGACACACTTCAGCCCTGG + Intronic
1081031782 11:38093573-38093595 CTGTTGACGCAGTTCTGACTAGG + Intergenic
1081483113 11:43507116-43507138 CCGCTGACATCGTTCAGGCTGGG + Intergenic
1084162511 11:67357408-67357430 CTAGTGACTCAGTCCTGGCTGGG - Intronic
1085177800 11:74506146-74506168 CTGCTGACACTCTTCTACCTTGG + Intronic
1085356561 11:75843511-75843533 CTGCTGACACAGTCCAAGCCTGG - Intronic
1086390789 11:86360685-86360707 CTGAAAACACAGTTCTGGCCAGG - Intergenic
1086549803 11:88042596-88042618 CAGCTGACACAGATCTACCTGGG - Intergenic
1094467482 12:30769124-30769146 ATGCTGACACATTTCTGGGGAGG - Intergenic
1094739744 12:33275182-33275204 CTGCTGACATAACCCTGGCTGGG - Intergenic
1095434393 12:42171284-42171306 CAGATTAAACAGTTCTGGCTGGG - Intronic
1095762334 12:45853744-45853766 CTGCTGACACAGTTCTGGCTTGG + Intronic
1096072325 12:48782314-48782336 ATGGTGACAGAGTTCAGGCTTGG + Intronic
1096141412 12:49245809-49245831 CTGAGGTTACAGTTCTGGCTGGG + Intronic
1101894469 12:108745613-108745635 CTGCTGATACCTTCCTGGCTGGG + Intergenic
1103270728 12:119671155-119671177 CTACTCACAAAGTTCTGTCTAGG - Intronic
1104922206 12:132296314-132296336 CAGCGGACACAGGTCTGTCTGGG + Intronic
1105550780 13:21393851-21393873 CTGCAGACACATTTCAGTCTGGG + Intronic
1110522834 13:76501054-76501076 CTGCTGAAACAGTCCTGCCGTGG + Intergenic
1112038029 13:95515700-95515722 CGGCTGACATAGTTCCAGCTTGG + Intronic
1114659746 14:24336531-24336553 CTGCTAACACAATTCTGGAGAGG - Intronic
1114750446 14:25198864-25198886 CTACTGCCACAGTTCTGGGGAGG - Intergenic
1115641215 14:35336825-35336847 CTGCTGACATAGGCCTGGGTTGG + Intergenic
1116562923 14:46404488-46404510 CTGCTTATACAGTTCTGAATTGG - Intergenic
1117014466 14:51504677-51504699 CTGGTAACACAGCTCTGTCTGGG + Intronic
1117381304 14:55166432-55166454 CTGATGAAAATGTTCTGGCTGGG + Intronic
1118194609 14:63612976-63612998 GGGCTGACACAGTCCTTGCTGGG - Intronic
1118327770 14:64793137-64793159 CTGCTGACGCAGGTCCGCCTGGG + Exonic
1118720883 14:68593075-68593097 CTGCTGGCCCAGTTCTGACCTGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1119949854 14:78733611-78733633 CTCCTGACAAAATTCTGGCCAGG - Intronic
1121969618 14:98344293-98344315 CTGCTGCAGCAGGTCTGGCTGGG - Intergenic
1122974521 14:105165627-105165649 CTGTTGACCCAGGCCTGGCTGGG - Intronic
1123834095 15:24170139-24170161 CTGCTGAGATATTTCTGTCTTGG - Intergenic
1124145779 15:27123983-27124005 CTGCTGACTCAGCCCTGCCTTGG + Intronic
1125503066 15:40251665-40251687 GTGCTGAGGAAGTTCTGGCTTGG - Exonic
1125944647 15:43703216-43703238 CAGCTGACTCAGCTCTAGCTCGG - Intergenic
1135338627 16:21627439-21627461 TTACTGACCCAGTTTTGGCTAGG + Intronic
1136158641 16:28403270-28403292 CTGATGCAACAGATCTGGCTTGG + Intronic
1136204447 16:28712013-28712035 CTGATGCAACAGATCTGGCTTGG - Intronic
1136666858 16:31819749-31819771 CTGGTGACAGCGTCCTGGCTGGG + Intergenic
1142321921 16:89388764-89388786 CTGCGGACAGGGATCTGGCTGGG - Intronic
1142928259 17:3259917-3259939 ATCCTGACACAGTTCTGACATGG + Intergenic
1144707984 17:17382337-17382359 CTGCAGACCAAGTTCTGGCCAGG - Intergenic
1146259818 17:31414025-31414047 CAGCTGACACAGAGCAGGCTCGG - Intronic
1146884442 17:36461790-36461812 CTGCTGTCACAGCTCTGGATTGG + Intergenic
1150560829 17:66293392-66293414 CCACTGACACTGTTCTGGCTGGG + Intergenic
1151664964 17:75540511-75540533 CTGCTGACAGGGTGCTGGCGAGG - Intronic
1156235899 18:35204516-35204538 CTGCTGACACCACGCTGGCTGGG - Intergenic
1156662393 18:39361299-39361321 CTGCTGCTACAGTTGTTGCTAGG + Intergenic
1157179745 18:45486337-45486359 CTCCTGACAAAATTCAGGCTAGG + Intronic
1157406186 18:47424377-47424399 CTGCTCACCCAGGTCTGGCTGGG - Intergenic
1160727932 19:626041-626063 CAGCTGACACAGTGCTCGCAGGG - Intronic
1162475974 19:10899528-10899550 CTGCTGACACCCTCCTGGCAGGG + Intronic
1162736025 19:12747602-12747624 CTGCTGAGCCAGTGCTGGGTGGG - Intronic
1163175929 19:15564079-15564101 CTGCTGAGCCTGTCCTGGCTGGG + Intergenic
1163283337 19:16330724-16330746 CAGCTGACACAGCTCAGGCCGGG - Intergenic
1163508223 19:17720419-17720441 CTGCCAACACAGGTCTGGTTTGG + Intronic
1163687416 19:18719645-18719667 CTGCTGACACAGGGCTTGCTTGG - Intronic
1165077941 19:33291154-33291176 CCTCTGACACATTTCAGGCTTGG + Intergenic
1167049197 19:47068342-47068364 CCATTGACTCAGTTCTGGCTGGG + Intronic
1167067780 19:47199844-47199866 CTGATGACACTGTACAGGCTTGG - Intronic
1167502315 19:49855137-49855159 CTGCTCACACAGTCCAGGCGGGG + Intronic
925971959 2:9112284-9112306 CTGTTGACACATTGCAGGCTCGG - Intergenic
927059730 2:19405618-19405640 AAGCTGACACAAATCTGGCTAGG - Intergenic
927444609 2:23148014-23148036 GTGAAGACACAGGTCTGGCTAGG - Intergenic
927795592 2:26045558-26045580 CTGCTACCACAGCTCTGCCTGGG - Intronic
933153346 2:78941256-78941278 CTGGTGACACTCTTCAGGCTTGG + Intergenic
934546335 2:95219878-95219900 CTGCTGACACCACACTGGCTGGG + Intronic
940087521 2:149877405-149877427 CAGCATACACAGTTCTGGGTTGG - Intergenic
940527126 2:154830559-154830581 CTGCTGACAGAGCACTGGCTGGG - Intronic
945007379 2:205423214-205423236 CTGAGGACACAGCACTGGCTGGG - Intronic
946888234 2:224246270-224246292 CTGGTGACACAGCACTGTCTTGG + Intergenic
948249009 2:236510427-236510449 GTGCTGACAGAGTTCTGATTGGG - Intergenic
948923946 2:241082050-241082072 CTCCTGACACCGCTCTGGCTGGG - Intronic
1169106231 20:2997441-2997463 CTCCTGACACAGTTCAAACTAGG - Intronic
1172871291 20:38136944-38136966 CTGGTGACAAAGTCTTGGCTCGG + Intronic
1173202336 20:40963074-40963096 CTGCAGACAGGCTTCTGGCTGGG + Intergenic
1173628972 20:44495672-44495694 CTCCTTACACAGTACTGGTTTGG + Intergenic
1176077836 20:63256563-63256585 CGGGTGACACAGTTGTGACTTGG + Intronic
1177003253 21:15639353-15639375 CTGTAGACAGAGTGCTGGCTGGG - Intergenic
1180058871 21:45374608-45374630 CTGATGACACTGTCCTGGCCTGG + Intergenic
1180695046 22:17746533-17746555 CTGGTGACACAGTTAGTGCTGGG + Intronic
1180842942 22:18967701-18967723 CTGCTGACCCAGTCCAGGCAGGG + Intergenic
1181058526 22:20271027-20271049 CTGCTGACCCAGTCCAGGCAGGG - Intronic
1181112626 22:20610944-20610966 GTGCTGTCACAGCTCTGGCCTGG - Intergenic
1184393275 22:44218044-44218066 CTGCTGACACCCCTCTGGATGGG - Intronic
953690534 3:45114137-45114159 CTGCTGACAGAGCTGAGGCTGGG - Intronic
956915073 3:73862324-73862346 CTGATGAATCAGTTCTGTCTAGG - Intergenic
961492735 3:127266549-127266571 CTGCTGACATCGTCCTGGCATGG - Intergenic
962144061 3:132821609-132821631 CTGCTGATTCAGTTCTATCTAGG + Intergenic
967143331 3:186583183-186583205 CTGCTTAGACAGTTTTGCCTGGG + Intronic
967494394 3:190126660-190126682 CTTCTGTCACAATTCTGCCTTGG + Intergenic
969463063 4:7338978-7339000 CCCCTGACACACTTCTGGCAGGG + Intronic
969923381 4:10561598-10561620 CTGAAGACACAGTTCTGGTCCGG - Intronic
971327554 4:25656550-25656572 CTGCTCACCCATTTGTGGCTTGG - Intronic
974405487 4:61462907-61462929 CTGTTGAAACAGTTCTGACTAGG - Intronic
975493588 4:75014387-75014409 CTAATGACAAAGGTCTGGCTGGG + Intronic
975661837 4:76696401-76696423 CTACTGAGCCAGGTCTGGCTGGG + Intronic
975718507 4:77228277-77228299 CAGCTGCCCCAGATCTGGCTGGG - Intronic
975725135 4:77284453-77284475 TGGCTGCCCCAGTTCTGGCTGGG - Intronic
975733342 4:77358616-77358638 CAGCTGCCCTAGTTCTGGCTGGG - Intronic
975735082 4:77373028-77373050 CGGCTGCCCCAGTTCTGGCTGGG - Intronic
975736809 4:77389184-77389206 CAACTGCCCCAGTTCTGGCTAGG - Intronic
976060520 4:81122927-81122949 CAGCTAAAACAGCTCTGGCTGGG + Intronic
976723042 4:88188506-88188528 CTTATTACAAAGTTCTGGCTGGG - Intronic
980886616 4:138769236-138769258 CTCCTGACAGAGCTCTGGTTGGG - Intergenic
984498104 4:180524181-180524203 ATGCTGAGACAGTTCTTGTTTGG - Intergenic
984771531 4:183440849-183440871 CTGCAGACATAGGTGTGGCTGGG - Intergenic
985645054 5:1080852-1080874 CTCCTGACACAGGGCTGCCTGGG + Intronic
986137065 5:4990310-4990332 CTGCTGACACTGTACGGGGTTGG + Intergenic
986717592 5:10535211-10535233 CTGCTGTCACCGTTCTGCCTTGG - Intergenic
989070521 5:37506195-37506217 CTGGTATCACAGTTCTGACTTGG + Intronic
990796174 5:59543622-59543644 CTGCTGGGACTTTTCTGGCTAGG + Intronic
991614106 5:68478211-68478233 CTGCTTACATAGTTAGGGCTCGG - Intergenic
992774468 5:80077501-80077523 CTGCTGTCTCATGTCTGGCTTGG - Intronic
993653779 5:90553861-90553883 CTGCTGACTCAGTTATAGCATGG + Intronic
996117578 5:119634782-119634804 CTGGGGAGACAGTACTGGCTCGG - Intronic
996885935 5:128353798-128353820 ATGCTGACACTGTACTAGCTGGG - Intronic
1000814595 5:165905304-165905326 CTGCAGACACAGTTTTGCCATGG - Intergenic
1001924206 5:175624435-175624457 CTGCTGGGACAGTTTGGGCTGGG + Intergenic
1003521323 6:6861059-6861081 CTGCAGACACAGTCCTGGGGCGG + Intergenic
1003685024 6:8294146-8294168 CAGCTGACACAGCACTTGCTAGG - Intergenic
1005583544 6:27254747-27254769 CTGCTCACATAGGTCTAGCTGGG - Exonic
1005985615 6:30872698-30872720 CTGCTGATATCATTCTGGCTAGG + Intergenic
1008685968 6:53926720-53926742 CTGATGACACACTGTTGGCTTGG - Intergenic
1010132931 6:72516733-72516755 CTACTGACACCATTCTGACTTGG + Intergenic
1011025823 6:82868167-82868189 CTGCTGAGACAGGTCTGCCCTGG + Intergenic
1011664037 6:89617871-89617893 CAGCTGGCACAGCTCTGGCCAGG - Intronic
1011733299 6:90288532-90288554 ATGCTGACTCAGCTCTGCCTGGG - Intronic
1011826815 6:91317416-91317438 CTGCTTCCAGAGCTCTGGCTTGG - Intergenic
1013011547 6:106125260-106125282 CTGCTGAGACAGTTTTGGGGTGG + Intergenic
1013771420 6:113632213-113632235 CTGCTGACAGAGGGTTGGCTAGG - Intergenic
1014888649 6:126814372-126814394 CAGCTGACAGAGTTCTGGTTGGG - Intergenic
1015418085 6:132973234-132973256 CCCCTGAAACAGTTCTGGTTTGG - Intergenic
1016818225 6:148323365-148323387 ATTCTGACATAGTTCTAGCTAGG + Intronic
1022206834 7:28172950-28172972 CTGCTGTCACATTTCTGTTTGGG - Intronic
1023483729 7:40662261-40662283 CTGGTGACACAGTGCAGGCTAGG - Intronic
1023754666 7:43405501-43405523 GTGCTGTCACAGTTCACGCTGGG - Intronic
1025204697 7:56985473-56985495 CTGATCACACAGATCTGGGTGGG - Intergenic
1026323287 7:69286215-69286237 CTGCTTCCACAGATCTGGGTAGG + Intergenic
1026774122 7:73220703-73220725 CTACTCACATAGTGCTGGCTGGG - Intergenic
1027014979 7:74774089-74774111 CTACTCACATAGTGCTGGCTGGG - Exonic
1027073052 7:75171864-75171886 CTACTCACATAGTGCTGGCTGGG + Intergenic
1033319632 7:140327962-140327984 CGGCTGACCCAGGTCTGCCTTGG - Intronic
1035551495 8:531002-531024 CTCCTGACTCAGTGCTGACTGGG - Intronic
1036716861 8:11133574-11133596 ATGCTAACACAGTACAGGCTAGG + Intronic
1037773963 8:21820500-21820522 CAGCTGACCCAGTTCTGCTTAGG + Intergenic
1039057188 8:33546262-33546284 CTGCTGACTCAGTGCTTCCTTGG + Intergenic
1039148989 8:34481781-34481803 TGGCTGAAACAGTTCTTGCTGGG - Intergenic
1040105956 8:43542082-43542104 CTGCTGAGCCTGTCCTGGCTGGG + Intergenic
1040451908 8:47556411-47556433 GGGCTAAAACAGTTCTGGCTTGG - Intronic
1040455490 8:47593800-47593822 CTGCTGACACCACCCTGGCTGGG + Intronic
1042841434 8:73127779-73127801 CTGCTGAAACACTTCCAGCTTGG - Intergenic
1043408526 8:79965867-79965889 CAGCTGACATTGTTCTTGCTTGG - Intronic
1044351201 8:91168408-91168430 CATGTGTCACAGTTCTGGCTAGG + Intronic
1044542282 8:93421180-93421202 CTGCTGACAGTGTTCTTTCTCGG - Intergenic
1046609190 8:116405207-116405229 CTGATAACTCAGTTCTGGCTTGG + Intergenic
1047211040 8:122840703-122840725 AAGCTGACACTGTTCTGGCCAGG - Intronic
1048177991 8:132170166-132170188 TAGCTTAAACAGTTCTGGCTGGG - Intronic
1048547800 8:135403792-135403814 CAGGTGTCACAGCTCTGGCTTGG + Intergenic
1049381584 8:142319095-142319117 CGGCTGCCACTGTTCTGGCTGGG - Intronic
1049392576 8:142379791-142379813 CTGCTGACATAGGCCTGGCAGGG + Intronic
1049580483 8:143408491-143408513 CTGGTGACCCAGGCCTGGCTGGG + Intergenic
1050448096 9:5748662-5748684 CTGGTAACACAGACCTGGCTAGG - Intronic
1052073267 9:24108961-24108983 CTGCTGACTCAGTACTAACTTGG - Intergenic
1053314253 9:37037967-37037989 ATGCTGACACAGTTCAGGCCCGG - Intergenic
1056304767 9:85279155-85279177 CTGTGGACACAATTTTGGCTAGG + Intergenic
1057477571 9:95415796-95415818 CTGCAGAGACACTGCTGGCTGGG - Intergenic
1057581518 9:96291302-96291324 CTGCTGATACCACTCTGGCTGGG - Intronic
1058639105 9:107065789-107065811 CTGCAGACCCATTTCTGCCTGGG + Intergenic
1060473410 9:123967488-123967510 CTGCTGACCCAGGCCAGGCTTGG + Intergenic
1061409954 9:130415006-130415028 CTGCTGGCACCATCCTGGCTGGG - Intronic
1062062310 9:134503017-134503039 CTGATGACTCAGCCCTGGCTAGG - Intergenic
1062283135 9:135760709-135760731 CTGGTGCCACAGCTTTGGCTTGG - Intronic
1187284219 X:17887295-17887317 CTGCTGACGCTGCTCTGGCAAGG - Intergenic
1191700617 X:64038203-64038225 AGGCTGTCACAGTTCTGCCTGGG - Intergenic
1200401865 X:156024511-156024533 CTCCTGTCACAGTTTGGGCTGGG - Intergenic
1200977283 Y:9226811-9226833 ATGGTGTCACAGTTCTGACTTGG + Intergenic