ID: 1095769240

View in Genome Browser
Species Human (GRCh38)
Location 12:45933842-45933864
Sequence CTGTAAAAGGGTTCTTCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095769236_1095769240 10 Left 1095769236 12:45933809-45933831 CCAGTCACTAGGATTCAAAGATG 0: 1
1: 0
2: 2
3: 7
4: 89
Right 1095769240 12:45933842-45933864 CTGTAAAAGGGTTCTTCTTTAGG 0: 1
1: 0
2: 0
3: 25
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095769240 Original CRISPR CTGTAAAAGGGTTCTTCTTT AGG Intronic
903105600 1:21076878-21076900 CTGAAAAAAGATTTTTCTTTTGG + Intronic
904269403 1:29339699-29339721 CGATAAAAGGGTTACTCTTTTGG + Intergenic
904960395 1:34328183-34328205 GTGAAAAAGCGTTGTTCTTTTGG + Intergenic
906861713 1:49367879-49367901 ATGTAGATGGGTTCTACTTTTGG - Intronic
908485112 1:64584073-64584095 CTGAAAATGGTTTCTTCTTTGGG - Intronic
911141987 1:94513912-94513934 CTGTAAAAAGGTTCTTAAATTGG - Intronic
915291882 1:154889820-154889842 CTGTAAAAGGCTTCTGATTCTGG + Intergenic
917074140 1:171186054-171186076 ATGTAAAAGATCTCTTCTTTTGG + Intronic
917256593 1:173122894-173122916 CTGTAGAAGGGTCTTTCTCTTGG - Intergenic
919115592 1:193276732-193276754 TTGTTTAATGGTTCTTCTTTGGG - Intergenic
921801194 1:219404340-219404362 CTGGAAAAGGATTACTCTTTTGG - Intergenic
923173503 1:231440050-231440072 CTGCAAAAGATATCTTCTTTTGG - Intergenic
924395979 1:243621338-243621360 CTGAAAACGTGTTCTTCTTTTGG + Intronic
924559415 1:245145157-245145179 TTGTAAATGGGATCTTCATTGGG - Intergenic
1063251503 10:4280020-4280042 TTTTAAGATGGTTCTTCTTTAGG + Intergenic
1064092323 10:12395612-12395634 CTGTAGAAGGGTTGGTTTTTCGG + Intronic
1067163514 10:43846704-43846726 CTGTAAAAGCGCTCTACTTTGGG - Intergenic
1069163100 10:65113877-65113899 CTATAAATGAGTTTTTCTTTAGG - Intergenic
1070082199 10:73199945-73199967 CTTTAAAAAGTCTCTTCTTTGGG + Intronic
1073898912 10:108196122-108196144 CTGGAAAAGGATTATTATTTTGG - Intergenic
1074417830 10:113282932-113282954 TTATAAAAGAGTTCTGCTTTGGG + Intergenic
1075666743 10:124236346-124236368 CTGTAAACATGTTCATCTTTGGG + Intergenic
1076658988 10:132042828-132042850 CTATAAAAGGCTTTTCCTTTGGG + Intergenic
1078795968 11:14591879-14591901 CTGTGGAAGGTTTGTTCTTTTGG + Intronic
1079951431 11:26809890-26809912 GTGTAAAAGCATTCTTTTTTCGG + Intergenic
1080185604 11:29481389-29481411 CTGTGAAAGTGTTATTATTTGGG + Intergenic
1081107733 11:39092787-39092809 TTGAAAAAGTGTTTTTCTTTGGG + Intergenic
1082663390 11:55943493-55943515 TTGTAAGAGGACTCTTCTTTTGG + Intergenic
1085517007 11:77117451-77117473 CTGCAGAAGGGTTCATCATTGGG - Intronic
1087689690 11:101306050-101306072 CTGGAAAAGTGTTCCTGTTTTGG - Intergenic
1088861184 11:113801161-113801183 CTATAAAAGAGTTCATCTTTTGG + Intronic
1090082726 11:123624805-123624827 CTTAAAAAGGGTTCTTTGTTGGG + Intronic
1091221672 11:133933339-133933361 CTATGATAGTGTTCTTCTTTTGG - Intronic
1094242954 12:28249932-28249954 CTGTAAAAATGTTCATTTTTTGG + Intronic
1095445535 12:42278563-42278585 GTGTAAAAGTGTTCCTATTTTGG - Intronic
1095769240 12:45933842-45933864 CTGTAAAAGGGTTCTTCTTTAGG + Intronic
1096280002 12:50244725-50244747 TTGGAAAAGGCTTCATCTTTAGG - Intronic
1097983597 12:65759257-65759279 GTGTTAAAGGATTCTTCCTTGGG + Intergenic
1099351965 12:81582977-81582999 CTGAATATGGGTTATTCTTTAGG - Intronic
1099943036 12:89212758-89212780 CAGTAAAAGGGATCTTTATTTGG + Intergenic
1100889492 12:99108823-99108845 GCATAATAGGGTTCTTCTTTAGG + Intronic
1107067818 13:36234595-36234617 CTGTAAAAGGGATCTTCAATAGG + Intronic
1108626279 13:52231584-52231606 CTGTAAATGAGTTTTTCTTTAGG - Intergenic
1108659787 13:52574898-52574920 CTGTAAATGAGTTTTTCTTTAGG + Intergenic
1114488160 14:23076910-23076932 TTGGAAAAGGGTTTTTCTTCTGG - Intronic
1115808348 14:37077680-37077702 ATGTAAAAGTCTTTTTCTTTAGG - Intronic
1116281781 14:42917300-42917322 CAGTAAAAGGGTTCTCATTAGGG + Intergenic
1116817775 14:49599388-49599410 CTCTCAAAGCTTTCTTCTTTCGG - Intronic
1117542833 14:56765108-56765130 CTATAAAAAGATTTTTCTTTTGG + Intergenic
1119274228 14:73339070-73339092 CTGTAAAAGTGTACTACTTTAGG + Intronic
1120502339 14:85311843-85311865 AAGCAAAAGTGTTCTTCTTTGGG - Intergenic
1121145543 14:91578977-91578999 CTGTAGAAGCTTTGTTCTTTTGG + Intergenic
1202943255 14_KI270726v1_random:3130-3152 GTCCACAAGGGTTCTTCTTTGGG - Intergenic
1124659109 15:31530752-31530774 CTGTAAACGGCTTCTTCCTCTGG - Exonic
1126312889 15:47337116-47337138 CTGGACTAGGGTTCTTCTTATGG - Intronic
1126984709 15:54291428-54291450 ATGTAAAAGGGATTTTATTTTGG + Intronic
1128476345 15:68000135-68000157 GTGTAAAAGCCTTCTTCTTAAGG + Intergenic
1130331883 15:82928860-82928882 CTGTAATAGGATTCATCTGTTGG - Intronic
1131126066 15:89858115-89858137 CTGGAAAAGGGTTCTTAGTTAGG + Intronic
1131683408 15:94747398-94747420 CTTTTAAAGCGTACTTCTTTGGG - Intergenic
1135074949 16:19385025-19385047 CTGTAAAATTGTTCCTCTTCTGG - Intergenic
1136238011 16:28926192-28926214 GTGTAAAAGCGTTCTACCTTTGG - Intronic
1138235421 16:55378094-55378116 CTGCTTAAGGGTTCTTCTCTTGG + Intergenic
1139044405 16:63039140-63039162 CTATAAAAGGGATCTTTTGTGGG + Intergenic
1144063494 17:11603926-11603948 CTGGAAACGCTTTCTTCTTTGGG + Intronic
1147683007 17:42265698-42265720 ATGTAAATGGGTGCTTTTTTTGG - Intronic
1149852177 17:60044410-60044432 CAGAAAAAGGCTTCTTCTCTGGG + Intronic
1149855133 17:60075982-60076004 CTTTAAAAGCATTCTTATTTAGG + Intronic
1150530100 17:65970989-65971011 TTGTAAAGGGCTTCTTATTTTGG + Intronic
1152869127 17:82742357-82742379 CTGCTAATGGGTTCTGCTTTAGG - Intronic
1153967059 18:10191628-10191650 CTGTAGAAGCTTTGTTCTTTTGG - Intergenic
1155037409 18:22036577-22036599 CCGTAAAAGTGATTTTCTTTTGG + Intergenic
1155654876 18:28180734-28180756 GTGTACAAGGGTTCTTGCTTTGG + Intergenic
1156000972 18:32383499-32383521 CTTTTAAAAGGTTCTTTTTTAGG - Intronic
1156184578 18:34647105-34647127 CTGTCCAATGGTTCCTCTTTAGG + Intronic
1156652055 18:39236120-39236142 CTGTAGAAGCTTTGTTCTTTCGG + Intergenic
1157957999 18:52120573-52120595 TTTTAAAAGGATCCTTCTTTTGG + Intergenic
1159191429 18:65048936-65048958 CAATTAAAGGTTTCTTCTTTTGG - Intergenic
1159353111 18:67300171-67300193 CTGGAAGAGGGTTCTTTTTCTGG - Intergenic
1160050126 18:75425732-75425754 ATGTAAAAGAGTTCATCTTCTGG - Intronic
1161116519 19:2499984-2500006 ATCTAAAAGGGTTCTGCCTTTGG - Intergenic
1163363903 19:16865604-16865626 CGGTGACAGGGTTCTTCTTGAGG - Exonic
1166714609 19:44958798-44958820 CTGTAAAAGGGAACTTTTTGAGG - Intronic
1166845934 19:45728531-45728553 CTGGGCAAGGGTTCTTCTTTTGG - Intronic
1166887253 19:45969605-45969627 CTGTATATGGGTTTTTATTTTGG + Intronic
926036357 2:9638807-9638829 CTGCAAAAGGTTTCTTCACTGGG - Intergenic
927734330 2:25504910-25504932 CTCTAAATTTGTTCTTCTTTTGG - Intronic
929337340 2:40765141-40765163 CTGTAACAGGGATATTCTTTTGG + Intergenic
930182404 2:48375039-48375061 CTGTAATTGTGATCTTCTTTTGG - Exonic
932796186 2:74698132-74698154 GTTTTAGAGGGTTCTTCTTTGGG - Intergenic
933973804 2:87491760-87491782 TTGTAAAAACCTTCTTCTTTAGG + Intergenic
934706384 2:96484527-96484549 TTTTAAAAGGGTTCTACCTTAGG + Intergenic
934881212 2:97981669-97981691 GGGTACAAGGGTTTTTCTTTGGG - Intronic
936319920 2:111458449-111458471 TTGTAAAAACCTTCTTCTTTAGG - Intergenic
937610141 2:123851376-123851398 CTATAAAAGGCTTCTTCATGAGG + Intergenic
938373947 2:130792019-130792041 CTTTAAAAGGGTGATTTTTTTGG - Intergenic
938962643 2:136356961-136356983 TTGTAAAAGGGTGCCCCTTTGGG - Intergenic
939297309 2:140284306-140284328 CTGAAAAACGGTTTTTTTTTGGG - Intronic
939388423 2:141533228-141533250 CTGTAATATGATTCTACTTTTGG + Intronic
940442204 2:153729849-153729871 TTGTAAATGGGTTCTTAATTTGG - Intergenic
940480456 2:154223114-154223136 CTATAAAAGGGTCCACCTTTAGG + Intronic
940646625 2:156398944-156398966 ATTTAAAAGGGATCTTCTCTGGG + Intergenic
941324252 2:164093487-164093509 CTGTTAAAAGATTCTTATTTGGG + Intergenic
941925929 2:170894728-170894750 CTGCAAAAGGATTCTATTTTCGG + Intergenic
942239304 2:173944597-173944619 CTGTAATAAAGTTCTTCTCTTGG + Intronic
942313585 2:174679129-174679151 CTGTAAAAGGATTGTTCTAAGGG - Intronic
942907133 2:181197056-181197078 GTGTAAAATGGTTCTCATTTTGG - Intergenic
943543944 2:189251459-189251481 CTTTAGAAGGGTTAATCTTTTGG - Intergenic
944482925 2:200175526-200175548 CTGTGGAAGGTTTGTTCTTTTGG + Intergenic
944523837 2:200598363-200598385 CTCTAACAAGGTGCTTCTTTAGG - Intronic
944590912 2:201217263-201217285 CTGAAAAAAGTTTCTTCTCTGGG + Intronic
944998898 2:205326790-205326812 TTGGAAAAGGGCTCTTCATTAGG + Intronic
947346269 2:229192344-229192366 ATGTCAAAAGGTTCTTCTTTTGG - Intronic
947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG + Intronic
947813955 2:233023576-233023598 CTGGAAATGGGTTTTTCTTGGGG + Intergenic
1169535849 20:6539114-6539136 CTCTAACAGTGTTCTGCTTTGGG + Intergenic
1169765503 20:9143887-9143909 CTGCAAAAGGGATCTTAATTTGG + Intronic
1169795124 20:9454123-9454145 TTGTAGAATGGCTCTTCTTTTGG + Intronic
1172027300 20:31957214-31957236 CTATAAATGGATTCTTCTTACGG + Intergenic
1177224987 21:18242963-18242985 CTGTAAACAGGTCCTTCTTTGGG - Intronic
1177240550 21:18450665-18450687 CACTTAAAGGCTTCTTCTTTTGG + Intronic
1180845625 22:18979875-18979897 CTGCTAATGGGTTCTGCTTTAGG + Intergenic
1181567043 22:23745175-23745197 CTTTAAAAATGTTCTTCTTTGGG + Exonic
950154209 3:10709447-10709469 CTGTTGAAGGGCTCTTCTTCAGG + Intergenic
951737686 3:25885816-25885838 CTGTGAAAAGGTTTTTGTTTTGG + Intergenic
952673425 3:35998767-35998789 CTGGTAATGGTTTCTTCTTTCGG + Intergenic
953122336 3:40057068-40057090 ATGCTAAAGGGCTCTTCTTTAGG - Intronic
953207284 3:40842488-40842510 CTATAGAAGGATTCTTTTTTTGG + Intergenic
953711160 3:45272468-45272490 CTGTGGAAAGGTTTTTCTTTAGG - Intergenic
954511730 3:51131447-51131469 ATGTAGTAGGGTCCTTCTTTGGG + Intronic
955119800 3:56046481-56046503 CTGTGAAAGGCTTCTTCAATGGG + Intronic
956264258 3:67379764-67379786 CTGTTAAATGGTATTTCTTTGGG + Intronic
956379160 3:68647631-68647653 CTGTAAATGTGATCTTATTTAGG + Intergenic
956515743 3:70045863-70045885 CTGTAAATGATCTCTTCTTTTGG + Intergenic
956617244 3:71184612-71184634 TTGGAAAAGGGTTCCTCTTTTGG - Intronic
957174853 3:76794030-76794052 CTGGAATAGGACTCTTCTTTTGG + Intronic
957470825 3:80655351-80655373 CGTTAAAAGGGATCTTGTTTGGG + Intergenic
957937644 3:86965308-86965330 CTGTATGAAGGTTCTTCTCTTGG + Intronic
959489435 3:106970529-106970551 TTCTAAAAGAGTTCTACTTTTGG - Intergenic
961076745 3:123989860-123989882 CTGGGAAAGGTTTCTTCCTTGGG + Intronic
962938019 3:140099534-140099556 CTGTGAATGTGTTCTTCTTTGGG - Intronic
963095207 3:141530339-141530361 CTGAAAAAGGTCTCTTATTTTGG - Intronic
964079312 3:152732649-152732671 CTTTAAAAGTGATCTTATTTGGG - Intergenic
964333696 3:155632443-155632465 CTGTAAAGCGGTTTATCTTTGGG + Intronic
964982005 3:162696172-162696194 CTTTAGAAGGTTCCTTCTTTAGG + Intergenic
967906287 3:194503315-194503337 CTTTAAAAGGCTTATTTTTTAGG + Intergenic
971158119 4:24104791-24104813 CTGTAAAAGGCTTTTTCCTCAGG - Intergenic
972255448 4:37350156-37350178 CTTTATATGGGCTCTTCTTTTGG + Intronic
972542525 4:40051917-40051939 CTGCAAAAGTTATCTTCTTTTGG + Intergenic
973861894 4:55073741-55073763 CTGTAACAGGGTTCTTACCTGGG + Intergenic
974362272 4:60897133-60897155 ATGCAAAAGGTTTCTTATTTGGG + Intergenic
974534046 4:63151906-63151928 CTGTAAGGGGGTTCTTATTTTGG + Intergenic
975541182 4:75514050-75514072 CTGGAACTGGGTTCTTCTTGAGG - Intronic
976140076 4:81982152-81982174 CTGTAAATGAGTTCCTTTTTGGG + Intronic
978560115 4:110024314-110024336 ATGTAAAGTGCTTCTTCTTTAGG - Intergenic
981170391 4:141616114-141616136 CTGTAGAAGCTTTTTTCTTTTGG + Intergenic
985316538 4:188663967-188663989 CTGTGAAAGTGGTCTTATTTGGG - Intergenic
988104248 5:26723056-26723078 CTGTGAAAACATTCTTCTTTTGG + Intergenic
989800864 5:45537152-45537174 CTGTAATAGGGTACTGCCTTAGG + Intronic
991423111 5:66461720-66461742 TTGAAAAAAGGGTCTTCTTTAGG + Intergenic
992246751 5:74833445-74833467 GTTTAAAATGGTTTTTCTTTAGG - Intronic
992537863 5:77729348-77729370 CTGGAAAAGTGTTCTCCATTAGG + Intronic
992865336 5:80952080-80952102 GTGTAAAAGCGTTCCTATTTGGG - Intergenic
994629141 5:102261003-102261025 CTGTAGAAGTATTTTTCTTTAGG - Intronic
994937296 5:106271561-106271583 CTGTAAATGTGTTCTTTTTTTGG - Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
995867192 5:116703955-116703977 TTGTACAAGTGTTCTACTTTGGG - Intergenic
996997226 5:129712340-129712362 ATGTAAAATGTTTCTTTTTTAGG - Intronic
999308329 5:150535191-150535213 CTGTAAAGGGGTTATTCTCTTGG - Intronic
1002548525 5:179969555-179969577 TTTTAAAAGGGTGCTTCTGTTGG - Intronic
1004882627 6:20023749-20023771 CTGTGGAAGGGTTGTTCTTTTGG + Intergenic
1005319724 6:24641410-24641432 CTGGAAACAGGTTCATCTTTTGG - Intronic
1008551679 6:52638865-52638887 CTGTGAAAGTTTTGTTCTTTTGG - Intergenic
1009572509 6:65405613-65405635 CTACAAAAGAGCTCTTCTTTGGG - Intronic
1016924171 6:149325601-149325623 CTATAATATAGTTCTTCTTTAGG + Intronic
1016975506 6:149803603-149803625 CTGTAAAGCCGTTCTTGTTTTGG - Intronic
1026404795 7:70054009-70054031 GTGGAAAAAGGTTTTTCTTTTGG - Intronic
1033601711 7:142893389-142893411 CTGGAAAAGAATTCTGCTTTGGG - Intergenic
1034102879 7:148465960-148465982 CTGTTAATGGGTCCTTCTTCCGG - Intergenic
1035014200 7:155750252-155750274 ATGTAACAAGGTTGTTCTTTTGG - Intronic
1036661628 8:10713022-10713044 CTGTAAATTGGTCCTGCTTTTGG - Intergenic
1040773979 8:51016319-51016341 CTGTAAGAGTGTTTTCCTTTAGG + Intergenic
1041978156 8:63823317-63823339 CTGTAAAAATGTTCATTTTTTGG + Intergenic
1042830611 8:73023860-73023882 CTGTAAATTGGTACTTCTTTGGG + Intronic
1042997167 8:74713858-74713880 CTTTAATATGGTTTTTCTTTAGG - Intronic
1043851481 8:85221103-85221125 CTTTAATAGGGTTATTCTCTTGG - Intronic
1044563176 8:93633725-93633747 CTCTAAAACGTTTCCTCTTTGGG - Intergenic
1045417344 8:101980357-101980379 CTGTGACATAGTTCTTCTTTGGG - Intronic
1047257873 8:123229461-123229483 CTGTAAAGGCTTCCTTCTTTTGG + Intronic
1047379757 8:124348765-124348787 CTGTGAAAGAATTCTTATTTGGG - Intronic
1047444584 8:124907954-124907976 TTGTATAAGCGTTCTTTTTTAGG - Intergenic
1047671061 8:127147826-127147848 CTTTAAAAGTGTTCTTACTTAGG - Intergenic
1047766003 8:127990437-127990459 CTTTAAAAACTTTCTTCTTTTGG - Intergenic
1050043389 9:1519033-1519055 ATGTGAAACAGTTCTTCTTTGGG + Intergenic
1060138267 9:121179246-121179268 CTATAATAGGGTTTTTCTTCAGG - Exonic
1060935728 9:127514679-127514701 ATGTAAAAGCCTTCTTCCTTTGG + Intronic
1186392536 X:9175215-9175237 CTGAAAAAGGGGGCTGCTTTGGG + Intergenic
1186556645 X:10567076-10567098 CTGTAAAGGGCTTCTTATTCGGG + Exonic
1187455961 X:19441466-19441488 CTTTAAATGGGTTGTTTTTTGGG + Intronic
1189032991 X:37468660-37468682 TTGTAAAAGCATTCTTCTTTCGG - Intronic
1194330276 X:92574985-92575007 CTGTAAAAGTGCGCTGCTTTTGG + Intronic
1195878044 X:109562874-109562896 CTCTAAAAGGATCCATCTTTTGG - Intergenic
1196551006 X:117025070-117025092 CTGTAAATTGCTTCTGCTTTAGG + Intergenic
1196667640 X:118333073-118333095 CTGTATAAAAGTTCTCCTTTTGG - Intergenic
1196740699 X:119023412-119023434 CTGTTAAAAGGTTCATGTTTGGG - Intergenic
1197101502 X:122661400-122661422 CTGAAAAACAGTTCTTGTTTGGG + Intergenic
1198464824 X:136895450-136895472 CTGTATGATGGTTCTTCTCTAGG - Intergenic
1198546094 X:137694437-137694459 CTTTAAAAAGGTTTTTCTTTTGG - Intergenic
1200291782 X:154882261-154882283 CTGTACAAGGCTTCTGCTTCTGG - Intronic
1200334783 X:155338578-155338600 TTGTAAATGGGTTCTTCATTTGG + Intergenic
1200338620 X:155377998-155378020 CTGTACAAGGCTTCTGCTTCTGG - Intergenic
1200347849 X:155462694-155462716 CTGTACAAGGCTTCTGCTTCTGG + Intergenic
1200351683 X:155502643-155502665 TTGTAAATGGGTTCTTCATTTGG - Intronic
1200638984 Y:5694161-5694183 CTGTAAAAGTGCACTGCTTTTGG + Intronic
1201011755 Y:9554010-9554032 ATGTCAAAGAGTGCTTCTTTTGG - Intergenic