ID: 1095772081

View in Genome Browser
Species Human (GRCh38)
Location 12:45971147-45971169
Sequence CATTAAATGAAGAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 439}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095772081_1095772084 23 Left 1095772081 12:45971147-45971169 CCTGCTTCCTTCTTCATTTAATG 0: 1
1: 0
2: 2
3: 40
4: 439
Right 1095772084 12:45971193-45971215 TTGTACTGTTGCATGCAGCAAGG 0: 1
1: 0
2: 0
3: 16
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095772081 Original CRISPR CATTAAATGAAGAAGGAAGC AGG (reversed) Intronic
902269881 1:15296157-15296179 TATCAAAGGAAGAAGGAAGGAGG + Intronic
903512672 1:23888067-23888089 CATTATGTGAAGCAGGAAGCAGG - Intronic
904567269 1:31435274-31435296 CATTGAATGAATGAGGAACCAGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905192726 1:36248174-36248196 TATTAAAAGATGAAGGAGGCTGG - Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905792078 1:40795127-40795149 CATTCTATGTATAAGGAAGCTGG - Intronic
905944440 1:41889872-41889894 CACTTAATGAACAAAGAAGCAGG + Intronic
906375935 1:45296664-45296686 CAGTCAATGAACCAGGAAGCAGG + Intronic
907398194 1:54207050-54207072 GGTTAAATGAAGAAAGCAGCGGG - Intronic
907981269 1:59483888-59483910 AAATAAAAGATGAAGGAAGCAGG + Intronic
908555024 1:65249063-65249085 TATGAAATGAAGAAGGAAACTGG - Intronic
910662365 1:89687570-89687592 GAGTAAATGGAGAAGGAAGTGGG + Intronic
911474117 1:98355249-98355271 TATTAAATGAAAAAGTAAGGAGG - Intergenic
911496314 1:98636100-98636122 CATTAAAAAAAGAAGAAAGCAGG + Intergenic
912564085 1:110572768-110572790 CATAAAATAATGTAGGAAGCAGG - Intergenic
912974117 1:114312456-114312478 CAGTAAATAAAGCAGGAATCAGG - Intergenic
914221119 1:145682742-145682764 CAGTAAATGAAGTAGAAATCGGG - Intronic
914473691 1:148005615-148005637 CAGTAAATGAAGTAGGAATCGGG - Intergenic
915918445 1:159956167-159956189 CCTTAAACAAAGAAGGAGGCTGG + Intergenic
915918670 1:159957949-159957971 AGATAAATGGAGAAGGAAGCAGG + Intergenic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
917713893 1:177714220-177714242 CATTTCATAAAGAAGGAAGTTGG + Intergenic
918363441 1:183782389-183782411 CATTACATGGACAGGGAAGCTGG + Intronic
920041498 1:203100633-203100655 CATTACATGAAGAATGCAGCTGG - Intronic
920069362 1:203291115-203291137 TATTTTATGGAGAAGGAAGCTGG - Intergenic
920362327 1:205427767-205427789 CATGAAATGGAGAAGGAATGAGG + Intronic
920530686 1:206700019-206700041 TTTTAAATAAAGAAAGAAGCAGG + Intronic
920788001 1:209061198-209061220 CATTAAATGAAGTGGGATGGTGG + Intergenic
920791805 1:209099923-209099945 TATTAAATGAAGTAGTAAGTCGG - Intergenic
920933987 1:210414141-210414163 CAATCTATGAACAAGGAAGCGGG - Intronic
921502971 1:215929388-215929410 TATTAGATGATGAAGTAAGCAGG - Intronic
921911563 1:220554592-220554614 TAGTAAATGAAGCAGCAAGCTGG + Intronic
922168776 1:223137822-223137844 CATAAAAGAAAGAAGGAAGGAGG - Intronic
922472357 1:225884085-225884107 CATTCATTGAGGAAGGAAGGAGG - Intergenic
924020028 1:239771213-239771235 GATGAAATGAAGAAGGGAGAGGG - Intronic
1063401560 10:5751346-5751368 TAATAAATGCAGAAGGAATCTGG - Intronic
1063829152 10:9932286-9932308 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1064447277 10:15406939-15406961 AAATAAATGAGGGAGGAAGCTGG + Intergenic
1064520944 10:16200184-16200206 AATTAAAAGAAAAAGGAGGCTGG + Intergenic
1064688964 10:17894238-17894260 CATCAAATGAAGCAGGAAAATGG + Exonic
1064741018 10:18434795-18434817 AATTACAAGAATAAGGAAGCAGG + Intronic
1065044231 10:21731595-21731617 TATAAAATGAAGAAGCTAGCCGG - Intronic
1065642996 10:27804120-27804142 CATGAAAGAAAGAAGGAAACGGG + Intergenic
1066384826 10:34933245-34933267 CCTTAAAGGAAGAAGCCAGCTGG + Intergenic
1066620025 10:37338447-37338469 GATCAGATGAAGAAAGAAGCAGG + Intronic
1067284129 10:44895054-44895076 TATTAAATGAAGATGGAATGTGG - Intergenic
1067753966 10:48990256-48990278 CATTGAATGAAGAACAAAGTTGG + Intergenic
1068138902 10:52979351-52979373 AATTAAAGAAAGAAGGAAGGAGG - Intergenic
1068151049 10:53132222-53132244 CATTTATTGAAGTAGGAAACTGG + Intergenic
1068427616 10:56888060-56888082 CAGTAAATGAAGTAGAAATCAGG - Intergenic
1068558365 10:58483374-58483396 CCTTAAATAAAGATGGAAGTAGG - Intergenic
1068731813 10:60366582-60366604 CATTGAAGGAAGAAAGAAGGGGG + Intronic
1070379553 10:75868350-75868372 CATAAAAAGAAAAAGGAAACAGG - Intronic
1070791010 10:79189360-79189382 CATCAGAGGCAGAAGGAAGCTGG - Intronic
1071200747 10:83219110-83219132 CATTAAATGAACAGGGAAGCAGG - Intergenic
1071362332 10:84861272-84861294 TGGTAAACGAAGAAGGAAGCAGG + Intergenic
1071578700 10:86750505-86750527 CATTAAATGGAGAATGAATATGG + Intergenic
1072105408 10:92269051-92269073 CCTCAAATGAGTAAGGAAGCTGG + Intronic
1072600377 10:96921440-96921462 AATTAAATAAAGAATGAAGCTGG - Intronic
1073857830 10:107697631-107697653 CATTAAAAGAGGAAGGGAGGAGG - Intergenic
1074249399 10:111729518-111729540 CATTTGATGAAGATGGAAGTAGG + Intergenic
1074358067 10:112803362-112803384 TCTAAAATGAAGAAGGAGGCTGG - Intronic
1074744150 10:116514889-116514911 TTTTAAATGAAGAATGAAGAAGG + Intergenic
1074792826 10:116908871-116908893 CAGTAAATGGAGAAAGAAGTTGG - Intronic
1075831403 10:125414642-125414664 CATTAAAGTCAAAAGGAAGCTGG + Intergenic
1077857171 11:6139778-6139800 CATAAAAAGAAAAATGAAGCTGG + Intergenic
1077950883 11:6955419-6955441 CTTTACATGAACAAGGATGCGGG - Intronic
1079347241 11:19663642-19663664 GATAAAATGAAGAAGGAAGGAGG - Intronic
1080060669 11:27953429-27953451 TAATTAATGAAGAAGGAAGAAGG + Intergenic
1080904772 11:36531874-36531896 CATTAAAGTCAGAAGGAAGAAGG - Intronic
1083028222 11:59568785-59568807 AAATAAATGAATAAGCAAGCCGG - Intergenic
1083031427 11:59596532-59596554 TATTTAAAGTAGAAGGAAGCAGG + Intronic
1083042089 11:59698960-59698982 CATAAAATTAATAAGGAAACAGG - Intergenic
1084878987 11:72156145-72156167 CATTACACAAATAAGGAAGCAGG + Intergenic
1084884169 11:72192544-72192566 CATTACAGAAATAAGGAAGCAGG + Intronic
1085492969 11:76938478-76938500 CAATAAATAAATAAGTAAGCCGG - Intronic
1086298120 11:85394816-85394838 CAGTAAATGAAGTAGGAATTAGG - Intronic
1086528503 11:87756855-87756877 AATTGAAGGAAGAAGGAAGCAGG - Intergenic
1087009256 11:93498297-93498319 CTTTAAATGAATAAGTCAGCAGG - Intronic
1087057872 11:93951316-93951338 CATGAAATGACAAAAGAAGCAGG + Intergenic
1087079181 11:94153218-94153240 CATACAAAGAAAAAGGAAGCAGG - Intronic
1088765241 11:112969127-112969149 CATTAGATGGAGCAGGAAGAAGG + Intronic
1088820437 11:113452074-113452096 CATTAAAAGAAGAAGCGTGCAGG - Intronic
1089360391 11:117882157-117882179 CATTCTATGAAGAGGGATGCCGG - Intergenic
1089502012 11:118938202-118938224 CAATAAATGAAGAAGAAAAATGG + Intronic
1090422267 11:126583649-126583671 CATTTTACAAAGAAGGAAGCAGG - Intronic
1090979127 11:131701701-131701723 CATTAAATGAAGAAATAACAAGG - Intronic
1091472988 12:746202-746224 TAATATATGAAGAAGTAAGCGGG - Intergenic
1091959825 12:4684236-4684258 AAATAAATGAAAAAGGAAGCTGG - Intronic
1092159356 12:6307575-6307597 CAGTAAATGTGGAAGGAAGGGGG + Intergenic
1092292525 12:7170656-7170678 CATTAAATAAGGAAGGGAGAAGG - Intergenic
1092484167 12:8887529-8887551 AATTATATGATGCAGGAAGCTGG - Intergenic
1092646019 12:10572824-10572846 CTTTAAATGAAAAAGGAAAGAGG + Intergenic
1093720843 12:22440154-22440176 CAATAAATGAAGCAAAAAGCTGG + Intergenic
1093887446 12:24478813-24478835 AATTAAATGGAGAAGGAATTGGG - Intergenic
1093967511 12:25342748-25342770 CAATAAATGTTGAGGGAAGCTGG - Intergenic
1094074515 12:26458182-26458204 CACAAAATGAAGATGGCAGCAGG + Intronic
1094332042 12:29304297-29304319 CATTTACTGAATAAGGCAGCTGG + Intronic
1094452799 12:30600578-30600600 CATTAATTCAAGAAGGAAAATGG + Intergenic
1095430539 12:42129255-42129277 CATTAAAGGAAGAAGTAGCCAGG + Intronic
1095772081 12:45971147-45971169 CATTAAATGAAGAAGGAAGCAGG - Intronic
1096464753 12:51842149-51842171 CGTAAAATGAGGAAGGCAGCTGG - Intergenic
1096730142 12:53603495-53603517 CAGCAAATTTAGAAGGAAGCAGG - Intronic
1097561672 12:61214292-61214314 CATTTAATGGACAAGTAAGCTGG - Intergenic
1097606340 12:61759075-61759097 CTTGAAATACAGAAGGAAGCTGG - Intronic
1098472618 12:70862973-70862995 CATAAAAGGAAGAAGGAAACTGG + Intronic
1098537406 12:71608953-71608975 CATTTAATCAAAAAGAAAGCTGG - Intergenic
1098847319 12:75553630-75553652 CATTTCATGAATGAGGAAGCTGG + Intergenic
1100225750 12:92553837-92553859 CATAAATTGAGGAAAGAAGCAGG - Intergenic
1100754862 12:97740052-97740074 AATTAGATTAAGAAGGAAGTTGG + Intergenic
1101086375 12:101240494-101240516 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1101583453 12:106064728-106064750 CATGAAATGAGGCAGGAAGTAGG + Exonic
1102990445 12:117311890-117311912 CATGGAATGAAGAAGGGAGAGGG - Intronic
1103172260 12:118831712-118831734 CCTTAAACAAAGAAGGAATCAGG - Intergenic
1103892481 12:124250283-124250305 CATGAAATGAACAAGGATGAAGG + Intronic
1104236906 12:126947692-126947714 GAGAAAAGGAAGAAGGAAGCTGG - Intergenic
1107050127 13:36038145-36038167 CATTTTATGAACAAGGAAGCTGG + Intronic
1108549960 13:51534126-51534148 CATTCAAAGAAAACGGAAGCTGG + Intergenic
1108730662 13:53232127-53232149 CATAAAGAGAAGAAGGAGGCGGG + Intergenic
1108780123 13:53820193-53820215 CATTCAATGAAGACTAAAGCAGG - Intergenic
1108954103 13:56129604-56129626 CCTTAAATGATGAAGGATGATGG - Intergenic
1109321583 13:60816784-60816806 CATTTAAAGAAGAATTAAGCTGG - Intergenic
1109373688 13:61459626-61459648 CAGAAAATGAAGAAGGAAAGAGG - Intergenic
1109558824 13:64019941-64019963 CATTCAATGAAGAGTGAAGATGG + Intergenic
1110216403 13:73029422-73029444 CAGTAATTGAGGAAGGAACCAGG - Intergenic
1110480377 13:75967177-75967199 TATTAAATGAAAAAGGAATTAGG + Intergenic
1110693055 13:78454708-78454730 CATTTCATGCAGAAGGAAGTTGG + Intergenic
1113240866 13:108335626-108335648 GATTTGATGATGAAGGAAGCGGG + Intergenic
1113283426 13:108816656-108816678 AATTACATGATGCAGGAAGCTGG - Intronic
1113433738 13:110272643-110272665 AATGAAAAGAAGAAGAAAGCCGG + Intronic
1113582044 13:111436869-111436891 CACTACTTGAAGCAGGAAGCTGG + Intergenic
1114037323 14:18641898-18641920 CATTTACTGAATAAGGTAGCTGG + Intergenic
1114121315 14:19673145-19673167 CATTTACTGAATAAGGTAGCTGG - Intergenic
1114161879 14:20177477-20177499 AATTACATGATGCAGGAAGCTGG + Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1115497141 14:34017105-34017127 CATTAAATGAAAAGGGAGCCAGG + Intronic
1115872895 14:37825269-37825291 CATTTAATAAACAAGGAATCAGG - Intronic
1117055317 14:51906222-51906244 AGTTAAATAAAGAAGGAGGCAGG - Intronic
1118049688 14:62013501-62013523 CAGTGAATGAAGAAGCAGGCAGG - Intronic
1118128247 14:62933827-62933849 GATTAAATGAAAAAGAAGGCAGG + Intronic
1118375031 14:65169426-65169448 GCTGAAATGAAGAAGGAGGCTGG + Intergenic
1118630490 14:67698005-67698027 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1120562501 14:86013052-86013074 CATTCGATGCAGGAGGAAGCAGG - Intergenic
1121057382 14:90869520-90869542 CAGTAAGTGAAGAAGGGAGGGGG + Exonic
1121097358 14:91226961-91226983 CATGAAATTGAGAAGGAGGCTGG + Intergenic
1121169229 14:91839123-91839145 CATTAAATAAAGAATGAATAGGG - Intronic
1121689703 14:95868494-95868516 CTCTAAATGAATAAGGAAGGAGG - Intergenic
1122383424 14:101327051-101327073 CCTTAAATGAAGCAGGAGCCAGG - Intergenic
1123907000 15:24931429-24931451 TTTTAAAGGAAGAATGAAGCTGG + Intronic
1125724249 15:41860358-41860380 AACTGAATGAAGAAGGAAGTGGG + Intronic
1126049208 15:44671561-44671583 AAATAAAGGCAGAAGGAAGCAGG + Intronic
1126069684 15:44854966-44854988 CATTATATGAAGGAGGAAATTGG - Intergenic
1126088847 15:45034196-45034218 CATTATATGAAGGAGGAAATTGG + Intronic
1126342258 15:47654094-47654116 CCTAAAATGAAGAAGAAAGAAGG + Intronic
1126481098 15:49121096-49121118 ACTTAAATGAGGAAAGAAGCTGG - Intronic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1127173432 15:56328077-56328099 CCTTACAAGCAGAAGGAAGCGGG - Intronic
1128703254 15:69819779-69819801 CATCAAAGAAAGAAGCAAGCAGG - Intergenic
1128902001 15:71431909-71431931 CAATAAATTAAGAAGAAATCAGG + Intronic
1128955286 15:71935248-71935270 AAAAAAATGAAGAAGGAAGATGG - Intronic
1130035754 15:80359977-80359999 CAATAAACAAAGAAGGAAGCAGG + Intronic
1130873375 15:87990672-87990694 AAATAATTGAAGAAGGAAGTTGG - Intronic
1131238386 15:90717086-90717108 CTTTAAAGGAAGTAGGCAGCTGG - Intergenic
1131890607 15:96968073-96968095 AATTAAATGAAGAAGGAGAGAGG + Intergenic
1133323298 16:4928139-4928161 CAAAAAATGAAAAAGGAGGCTGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134687077 16:16166349-16166371 CATTACATCAAGAAACAAGCAGG - Intronic
1135213866 16:20547392-20547414 CATTAGCTAAAGAAGGATGCAGG + Intronic
1135418275 16:22286064-22286086 CCTTAAATGAACAATGAAGCAGG + Exonic
1135730793 16:24893491-24893513 CAATAAAGGAAGGAGGAAGATGG - Intronic
1135885984 16:26308443-26308465 TATTAGATGACGAAGAAAGCAGG - Intergenic
1140163233 16:72521446-72521468 CTATAAATAAAGAAGGAAGCAGG + Intergenic
1141901368 16:86993316-86993338 CATCATATTAAGAAGGAAGTGGG - Intergenic
1143331569 17:6140169-6140191 CTTTGAATGATGAAGGAAGGTGG + Intergenic
1143360899 17:6370192-6370214 AATAAAATGAACAAGGAGGCCGG + Intergenic
1144256619 17:13474723-13474745 CGGTAAATGCAGAGGGAAGCAGG + Intergenic
1144594453 17:16556073-16556095 CATTAAGTGAAAAAAAAAGCAGG + Intronic
1144718863 17:17453918-17453940 CATTCAAGGAAAGAGGAAGCTGG - Intergenic
1144834198 17:18148412-18148434 CCTGAAAGGAAGAAGCAAGCAGG + Intronic
1146086910 17:29838366-29838388 CATGAATGGAAGCAGGAAGCAGG + Intronic
1146713629 17:35064712-35064734 CCTTAAAGGATGAACGAAGCTGG - Intronic
1146980161 17:37152860-37152882 CTGGAAATGAAGAAGGGAGCAGG - Intronic
1148078709 17:44955524-44955546 AAATAAATGCAGAAGGAACCAGG + Intergenic
1150051896 17:61972377-61972399 AATTAAATGAAAAAGGGAGGTGG - Intronic
1150194172 17:63277533-63277555 CACTAACTGAACAAGGATGCTGG - Intronic
1151695367 17:75713361-75713383 TATTAAATGTAGAAAGGAGCTGG + Intergenic
1151809508 17:76429641-76429663 CATTAGATGGAGTAGAAAGCTGG + Intronic
1152057497 17:78041421-78041443 TATTAAATAAAGAAGGAAACTGG - Intronic
1154975843 18:21456790-21456812 AAATAAATGCAGAAAGAAGCCGG - Intronic
1155365571 18:25046271-25046293 CAGGAGATGAAGAAGGAATCTGG + Intergenic
1155805501 18:30166065-30166087 CATTAAATGTTTAAGGAAGTTGG + Intergenic
1156445558 18:37234015-37234037 CATTGTCTGAGGAAGGAAGCAGG + Intergenic
1156801870 18:41125044-41125066 CATTAAAAGAGCCAGGAAGCTGG - Intergenic
1159673737 18:71254988-71255010 GATCAAATGAAGAAGACAGCAGG - Intergenic
1162173895 19:8815109-8815131 CATTACAAGAAAAATGAAGCTGG + Intronic
1163867667 19:19787691-19787713 CATTAAATGCAGCAAGATGCAGG + Intronic
1163952738 19:20605493-20605515 CATTAAATGCAGCAAGATGCAGG + Intronic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1165908986 19:39212359-39212381 GATTAAATTCTGAAGGAAGCCGG + Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1168143884 19:54408460-54408482 CAATGAAGGAAGAAGGAAGGAGG + Intergenic
925417490 2:3680830-3680852 CAGTAAATCAAGTTGGAAGCAGG + Intronic
925649282 2:6072070-6072092 CATTAGTGAAAGAAGGAAGCGGG - Intergenic
926701871 2:15809421-15809443 AATTAAATGGGGAAGGGAGCTGG + Intergenic
927270402 2:21203079-21203101 AAATAAATGAAGACGGAATCAGG + Intergenic
927666701 2:25037909-25037931 CATTAAATGGCAAAGGAATCCGG - Intergenic
928595403 2:32855158-32855180 CTCTAAATGTAGCAGGAAGCTGG + Intergenic
928789219 2:34931415-34931437 CATCAAATAAGGAAGGAAGCAGG + Intergenic
928823266 2:35389168-35389190 CATTTAATGAAGCATCAAGCTGG - Intergenic
929162394 2:38845434-38845456 CATTAAATGAATATGGAATTAGG + Intronic
929676162 2:43932262-43932284 CATTAAATGAAGAAAGATATAGG - Intronic
931155102 2:59619323-59619345 CATTGAAGGAATAACGAAGCAGG + Intergenic
931411711 2:62038847-62038869 CATTAAAAAAATAAGGAAACAGG - Intronic
931510865 2:62991996-62992018 GATTTAATGCAGAATGAAGCTGG + Intronic
933171221 2:79128113-79128135 CAGTAAATAAAGAAAGAATCAGG + Intergenic
935187321 2:100745879-100745901 CACTGGAAGAAGAAGGAAGCTGG + Intergenic
935375820 2:102396213-102396235 CATTTAACAAACAAGGAAGCCGG - Intronic
935601900 2:104930684-104930706 CATTAGATGTACAAGGAGGCAGG + Intergenic
935728863 2:106048190-106048212 AAAAAAATGAAGAAGGAAGTTGG - Intergenic
936490489 2:112967454-112967476 TAATAAATGAAGAAGGAATTAGG - Intergenic
937467586 2:122148241-122148263 TAGTAAATGAAGAAAGAAGAAGG + Intergenic
937512146 2:122608019-122608041 CATTATATGAATAAGGAACATGG + Intergenic
937609086 2:123839369-123839391 CTTTAAATCAAGAAGGAAAATGG + Intergenic
938273661 2:129997164-129997186 CATTTACTGAATAAGGCAGCTGG - Intergenic
938277973 2:130044397-130044419 CATTTACTGAATAAGGTAGCTGG - Intergenic
938328941 2:130435200-130435222 CATTTACTGAATAAGGTAGCTGG - Intergenic
938361006 2:130686292-130686314 CATTTACTGAATAAGGTAGCTGG + Intergenic
938437409 2:131292987-131293009 CATTTACTGAATAAGGTAGCTGG + Intronic
938478754 2:131640011-131640033 AATTAAATGAAGAAAAAAGCTGG + Intergenic
938872341 2:135492858-135492880 GATTAAATGAAAATGGAAGAAGG + Intronic
939155713 2:138522909-138522931 AATAAAATGAAAAAGGAAGGGGG - Intronic
939236743 2:139503958-139503980 CTTTTAATCAAAAAGGAAGCAGG + Intergenic
939343958 2:140938196-140938218 CATTAAAAAAAATAGGAAGCTGG - Intronic
940250548 2:151670941-151670963 CATTGAATTAAGAAGGACGGAGG + Intronic
940408564 2:153333473-153333495 CTTTAAATCAAGAAGGAAAATGG - Intergenic
940789704 2:158019174-158019196 CAGTAAATAAAGGAGGAATCAGG + Intronic
940863942 2:158798233-158798255 CATTAAAGAGAGAAGGAAGTTGG + Intronic
941371747 2:164673899-164673921 AATTACATCAAGAATGAAGCTGG + Intronic
941484565 2:166063708-166063730 CATTAAAAGAAAAACAAAGCAGG + Intronic
941992658 2:171572276-171572298 CAGCAAATAAAGTAGGAAGCAGG + Intergenic
942538738 2:176993501-176993523 CATTAAATCAAAAAGGAGGTAGG + Intergenic
942698320 2:178673137-178673159 CATTAAGTGAATTAGGAAGCAGG + Intronic
943090566 2:183369657-183369679 CATTCAATAAACAAAGAAGCAGG + Intergenic
944214098 2:197236633-197236655 CATTAAATGGAGAAAGAAAATGG - Intronic
944975613 2:205046968-205046990 CATTAAATTAAAAAGAAATCAGG + Intronic
945576510 2:211536643-211536665 CTTGAAATTAAGAAAGAAGCAGG + Intronic
946980160 2:225204417-225204439 CATTAAAGGGAGAAGGAAGGAGG - Intergenic
946983483 2:225245898-225245920 CAACAAATTCAGAAGGAAGCTGG + Intergenic
947394912 2:229676802-229676824 CATGAAATGGAGAGGGAAGCAGG - Intronic
947981996 2:234418535-234418557 AATGAGATGAAGAAAGAAGCAGG - Intergenic
948979112 2:241483748-241483770 CCTGGAATGAAGAAGGAGGCTGG - Intronic
1169665822 20:8034200-8034222 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1170266585 20:14472789-14472811 CATGAAATGATGAAGGAGCCTGG + Intronic
1170336394 20:15275021-15275043 CAATAATTGAAAAAGGAGGCTGG + Intronic
1171447921 20:25217746-25217768 CATTAAAGGATGAAGGAGGAGGG - Intronic
1171511598 20:25689983-25690005 CATTAAAAACAGAAGGCAGCTGG + Intronic
1172284055 20:33728605-33728627 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1172626139 20:36348209-36348231 CAGTTACTGAAGAAGGAAGGAGG + Intronic
1173184508 20:40830389-40830411 AATTAAATGAAGAAGAAAATTGG + Intergenic
1173238307 20:41269004-41269026 CATAAAGTGAAGAGGGAAACTGG - Exonic
1173626154 20:44474469-44474491 CCTTATAAGAAGAGGGAAGCAGG + Intergenic
1173914701 20:46698338-46698360 CCTTAAAAGTAGAAGGAGGCAGG - Intergenic
1173920359 20:46740165-46740187 CATTCAATGAAGTATGAGGCAGG - Intergenic
1174181703 20:48679251-48679273 CATTTAATGGAGAAGGAGACTGG + Intronic
1175633862 20:60564448-60564470 AATTAAATTAGGAAGGGAGCGGG - Intergenic
1177292049 21:19126254-19126276 CATTGAAGGAAGCTGGAAGCAGG + Intergenic
1177952855 21:27560535-27560557 CTTTATATGAAGAAGGAATTTGG + Intergenic
1178523765 21:33307225-33307247 CAGTAAATAAAGTAGGAATCAGG - Intergenic
1179491145 21:41742311-41742333 CATTAAAGAAAGAAGGAAAAAGG + Intronic
1180011623 21:45055077-45055099 CATTACATGAAGTGGGAAGGTGG - Intergenic
1180461448 22:15568946-15568968 CATTTACTGAATAAGGTAGCTGG + Intergenic
1180897872 22:19350411-19350433 CATTAAATCAAGAAGGTAACAGG - Intronic
1181347044 22:22227140-22227162 AAATAAAAGAAGAAGAAAGCTGG - Intergenic
1181871834 22:25905539-25905561 TATTTACTGAAGAGGGAAGCTGG + Intronic
1181959048 22:26609980-26610002 GATTAAAGGGAGAAGGAAACTGG + Intronic
1182665617 22:31957209-31957231 CATTAATTGAAGAAAGAGGTGGG - Exonic
1182973911 22:34604435-34604457 CAGGAAATGAAGAAAGAAGATGG + Intergenic
1183435476 22:37791964-37791986 CAATAAATGAATGAGGATGCAGG - Intergenic
1184278270 22:43422787-43422809 GGTTAAATGAAGAAGTAAGCAGG - Intronic
949356023 3:3181461-3181483 GATAAAATGAAGGAGGGAGCAGG - Intergenic
950827268 3:15837239-15837261 CAATAAATAAACAAGAAAGCAGG + Intronic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
951897862 3:27627539-27627561 TATTAAAAGAAAAAGGAGGCCGG + Intergenic
952234525 3:31464878-31464900 CATCAAAGGATCAAGGAAGCTGG - Intergenic
953850169 3:46459924-46459946 CATGAAATGGAGAGGGAAGGAGG - Intronic
953991509 3:47487413-47487435 CAGTAAATAAACAAGGAATCAGG + Intergenic
954417977 3:50403380-50403402 CATAAACTGAAGAAGAAAACAGG - Intronic
954431143 3:50471441-50471463 CAGAAGAGGAAGAAGGAAGCTGG - Intronic
954614412 3:51962280-51962302 CATTAACTGATGGAGGAAGGTGG + Intronic
955777833 3:62452573-62452595 AATTAATTGGAGGAGGAAGCAGG + Intronic
955795304 3:62630181-62630203 TATTGAATGAATAAGGAAACAGG + Intronic
956187675 3:66578049-66578071 CATTTTATGAAGAAGGGAGGAGG - Intergenic
957617024 3:82542939-82542961 CAGTAACTGAAGAAGGAAATGGG + Intergenic
958451383 3:94277598-94277620 CCCTAAAGGAAGAAGAAAGCTGG + Intergenic
958540039 3:95459112-95459134 CATTAACTGAAGAAGACACCTGG - Intergenic
960391878 3:117087202-117087224 CATTTAAGGAAGAAGCAAGCTGG + Intronic
960463842 3:117970537-117970559 CATAAAATGAAGAACAAAGTGGG - Intergenic
960603938 3:119485836-119485858 CTGAAAATGAAGAAGGGAGCAGG + Intronic
960746362 3:120894250-120894272 CATTAAATAAAGAAGGATTATGG + Intergenic
961595269 3:128011062-128011084 TATTAAAGGAAGTAGGAAGTGGG - Intergenic
962272270 3:133986593-133986615 CATATAAAGAGGAAGGAAGCGGG + Intronic
963538012 3:146552384-146552406 CACTTAATGGAGAAGGAGGCTGG + Intergenic
963644270 3:147894266-147894288 CATTAAATGATCAAGTAAGTTGG + Intergenic
965423553 3:168493306-168493328 GAATAAAGGAAGAAGGAACCAGG + Intergenic
965845275 3:172953805-172953827 CTTGAAAAGGAGAAGGAAGCTGG + Intronic
965909043 3:173748207-173748229 GATTTTATCAAGAAGGAAGCAGG + Intronic
966699509 3:182831551-182831573 TAGGAAATGAAGAAGGAACCAGG - Intronic
967066351 3:185920440-185920462 CAAAAAATGAGGCAGGAAGCCGG - Intronic
967877472 3:194277012-194277034 TGTTAAAAGATGAAGGAAGCTGG - Intergenic
968543753 4:1184521-1184543 CTTTAAAAGAAGAACAAAGCTGG + Intronic
969144433 4:5109062-5109084 CATTAACTGGACAAGGAAGCTGG - Intronic
970453470 4:16196586-16196608 CATTAAATGCAAAAGTAAACAGG - Intronic
970563851 4:17311594-17311616 CATGAAAAGAAACAGGAAGCAGG + Intergenic
970735887 4:19167412-19167434 CATAAAATGAAGAGCCAAGCTGG - Intergenic
970850237 4:20593805-20593827 CATACAATTAAGAATGAAGCCGG + Intronic
971199065 4:24495452-24495474 CAGGAAAGGAAGAAGGAAGCAGG + Intergenic
972353362 4:38258365-38258387 CAGGAAATGAAGAAGGCAGAGGG - Intergenic
973038515 4:45440042-45440064 CATTAAATAATAAAGCAAGCAGG + Intergenic
974167250 4:58219592-58219614 GATTAAATGAAGAAGTAACATGG - Intergenic
974259484 4:59507059-59507081 CATTAGATAAAGAAAGAACCTGG - Intergenic
974418244 4:61638902-61638924 AATTAAGTGAAGAGGAAAGCAGG - Intronic
974847838 4:67372699-67372721 CATTTACTGAAGATGCAAGCTGG - Intergenic
975176292 4:71293265-71293287 CATAAAATCCAGAAGGAGGCTGG + Intronic
975445459 4:74459034-74459056 AAAAAAATGAAGAAGGAAGGAGG - Intergenic
975796968 4:78016738-78016760 AGTTAAAAGAAGGAGGAAGCAGG + Intergenic
976049152 4:80990734-80990756 AATTAAATGACGAAGCAAGAAGG + Intergenic
976430991 4:84964169-84964191 CATGAAATTAAGAAAGAAGCAGG + Intronic
976633263 4:87261262-87261284 AAATAAATAAAGAAGGAAGCTGG + Intergenic
976759716 4:88535290-88535312 AATGAAATCAAGAAGAAAGCAGG - Intronic
978211408 4:106141446-106141468 CATTTTATGAACAAGGAAACAGG + Intronic
979340321 4:119514873-119514895 CATTATACAAAGAAGGAAACAGG + Intronic
979823112 4:125198633-125198655 CAGCAAAAGAAGAAGGAAGTGGG - Intergenic
981027863 4:140094764-140094786 CAGGAAAGGAGGAAGGAAGCGGG - Intronic
981826197 4:148944286-148944308 CATTAAAGGCAAAAGGATGCCGG - Intergenic
982220416 4:153119878-153119900 CAGTAAATAAAGTAGGAATCAGG + Intergenic
982385083 4:154792316-154792338 CATTAAATGTAGAAGTAAAATGG + Intronic
982470114 4:155778624-155778646 CATTAAATCAAGTTGGAAACTGG + Intronic
982721299 4:158862826-158862848 CATTAAGTGGAGAAGGAAAGGGG + Intronic
983678876 4:170329453-170329475 CATGAAATGGAGAGTGAAGCAGG + Intergenic
984183857 4:176518444-176518466 ACTTAAATGAAGAACAAAGCAGG + Intergenic
984448923 4:179874207-179874229 GATTAAATGAACAAGAAACCAGG + Intergenic
985125067 4:186684928-186684950 CATGAATTCAGGAAGGAAGCAGG + Intronic
986056644 5:4143821-4143843 CATAAAATGAAAAAGAAGGCCGG + Intergenic
987463696 5:18246983-18247005 CAGTAAATAAAGTAGGAATCAGG - Intergenic
988094224 5:26582314-26582336 CATTATATGAAGAGAGAATCTGG + Intergenic
988177043 5:27742332-27742354 CTTTAATTCAAGAAGGAAGATGG + Intergenic
988237868 5:28570246-28570268 CATTAAATGAATAAATAAGTAGG + Intergenic
991010590 5:61879077-61879099 CATTTTATGAAGGAGGAAACAGG + Intergenic
991482234 5:67093219-67093241 CATTAAATGAAAAAGTAAGAAGG - Intronic
992378869 5:76217319-76217341 ATCTAATTGAAGAAGGAAGCAGG + Intronic
992490162 5:77234840-77234862 CATTAAATGAACGAGAAAACAGG - Intronic
993462341 5:88199007-88199029 GATCAGATGAAGAAAGAAGCGGG - Exonic
996331488 5:122334460-122334482 CATTATATGAAAAAATAAGCTGG + Intronic
997474510 5:134134839-134134861 GAGTAAATGAAGAAGGATGCTGG + Intronic
997825492 5:137103279-137103301 TATTAAAAGAAGAACAAAGCCGG - Intronic
1000012889 5:157249275-157249297 CAGAAAATCGAGAAGGAAGCTGG - Intronic
1000567484 5:162867711-162867733 CAGTAGATGAAGGGGGAAGCAGG - Intergenic
1001138627 5:169124122-169124144 CATTAACTGAAGAAAAAAGGGGG - Intronic
1001220951 5:169900336-169900358 CATTGAAAGAAGGAAGAAGCAGG + Intronic
1001794429 5:174490286-174490308 CCATAAATGCAGAAGGCAGCTGG + Intergenic
1002380198 5:178822142-178822164 CAGAAAATTAACAAGGAAGCTGG - Intergenic
1002391328 5:178914640-178914662 CAATAAAGGAAGAAGGGAGGGGG + Intronic
1002773989 6:313271-313293 CATTTAATGGAGTATGAAGCAGG - Intronic
1004916565 6:20338290-20338312 CATGTAATGAATCAGGAAGCAGG + Intergenic
1005492461 6:26359408-26359430 CAATAAAAGAAGAAAGAGGCTGG - Intergenic
1005975949 6:30799401-30799423 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1006216042 6:32443590-32443612 GATTAAAAAAAGGAGGAAGCTGG - Intronic
1006915504 6:37591394-37591416 GATTAAAAGAAGTAAGAAGCGGG + Intergenic
1007212581 6:40207246-40207268 CAATAAGTGTAGAAGGAAGCAGG - Intergenic
1007278171 6:40690859-40690881 GATTAAATGGAAAAGGAATCTGG + Intergenic
1007754240 6:44088544-44088566 ATTTAAATGAAGAAGGAGGCTGG - Intergenic
1008117604 6:47570281-47570303 GATTTAATGAAGAAGGAGGAGGG + Intronic
1009507890 6:64508161-64508183 GTTTAAATGAAGAAAGTAGCAGG + Intronic
1011006942 6:82656137-82656159 CATGAAATGATGAAGTAAGCTGG + Intergenic
1011485571 6:87837636-87837658 GATTAAAACAAGAATGAAGCTGG + Intergenic
1011656750 6:89558938-89558960 AAATAAATGAAGGAGGAAACAGG + Intronic
1011786641 6:90853977-90853999 CATCAAAGGAATAAGCAAGCAGG - Intergenic
1011811742 6:91140060-91140082 CATTAAACCAGGAAGGAAGTAGG + Intergenic
1012210852 6:96517079-96517101 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1012708050 6:102559287-102559309 CATTAAATTAATAATGAAGGTGG - Intergenic
1012835862 6:104266362-104266384 AAAAAAATGAAGAAGGGAGCGGG - Intergenic
1012979725 6:105816733-105816755 CTTTGAAGGAAGAAGGAAGAGGG - Intergenic
1014044287 6:116866330-116866352 CATTAAAAAAAGAAAAAAGCAGG - Intergenic
1014322145 6:119943131-119943153 CTTTAATTCAAGAAGGAAGATGG - Intergenic
1014479065 6:121912443-121912465 GATTGACTGAAGAAGTAAGCTGG - Intergenic
1014592962 6:123295019-123295041 CAGGAAATGAGGAAGGAGGCAGG + Intronic
1014686850 6:124512397-124512419 CATTAAATGTAAAAGGAGGAAGG + Intronic
1014713513 6:124837829-124837851 AAGTAAATGAAAAAGGAACCAGG - Intergenic
1015515951 6:134082753-134082775 CAGTAAATAAAGTAGGAAGCAGG + Intergenic
1015555768 6:134459842-134459864 CAGTGAGTGCAGAAGGAAGCGGG - Intergenic
1015558748 6:134492057-134492079 TTTTAAATGAAGAACAAAGCTGG + Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1017006471 6:150031076-150031098 CCATAAATGATGAAGGAGGCTGG - Intergenic
1017095333 6:150799855-150799877 CGCAAAATGTAGAAGGAAGCAGG - Intronic
1018732406 6:166662041-166662063 CATTAAATCAGGAACAAAGCAGG - Intronic
1020216598 7:6196369-6196391 AATAAAATAAAGAAGCAAGCAGG + Intronic
1021194018 7:17654237-17654259 CATGAAATGGAGAATGAAACTGG - Intergenic
1021568720 7:22041848-22041870 CATTTAATGAAGAAAGTTGCAGG - Intergenic
1021782107 7:24116376-24116398 CAGTAAATAAAGTAGGAATCAGG + Intergenic
1022356062 7:29615661-29615683 CACCAAGTGAAGAAGGATGCAGG - Intergenic
1023474234 7:40559533-40559555 AATGAAATGAAGAAGAAAGGGGG + Intronic
1024750476 7:52459542-52459564 GATAAAATGAAAAAGGAAGAGGG + Intergenic
1025209585 7:57013167-57013189 CATTAAAAGATGAAGGCAGACGG - Intergenic
1025662366 7:63563683-63563705 CATTAAAAGATGAAGGCAGACGG + Intergenic
1025781512 7:64605951-64605973 CACTATGTGAAGCAGGAAGCAGG + Intergenic
1025835726 7:65091905-65091927 CACTAAATGAAGAAAGATGGTGG + Intergenic
1025905505 7:65781365-65781387 CACTAAATGAAGAAAGATGGTGG + Intergenic
1027381936 7:77620436-77620458 CATTACATGAAGAAGAAAAAAGG - Intronic
1028514716 7:91664433-91664455 CATTAAATTAAGGAGGAAGTGGG + Intergenic
1028633901 7:92965942-92965964 CATAAAATGTAGAAAGAGGCTGG + Intergenic
1028990332 7:97042493-97042515 CAATAAATAAAGAGGGAAACTGG - Intergenic
1030180685 7:106705643-106705665 CACTCAATGAAGAAGTAAACTGG - Intergenic
1030183462 7:106735375-106735397 TATTAAAAGAAGATAGAAGCTGG - Intergenic
1030455245 7:109764502-109764524 CTTTAAATGAAGTAGTAATCTGG + Intergenic
1031112548 7:117629928-117629950 AATTAAGTGAGTAAGGAAGCAGG + Intronic
1031246122 7:119313976-119313998 CTTTAAATGAAGAGGGAACATGG + Intergenic
1031808635 7:126338442-126338464 CACTAAATAAGCAAGGAAGCAGG + Intergenic
1032134701 7:129265252-129265274 CATTATATGAAGCAAGAAGGAGG + Intronic
1032412637 7:131709149-131709171 TAATAAATGAAGAAGGAAGAAGG - Intergenic
1032541359 7:132705702-132705724 CCTTATATGCAGAAGGAAACAGG + Intronic
1032783301 7:135181825-135181847 AATTACGTGAAGCAGGAAGCAGG - Intergenic
1034109598 7:148523232-148523254 CATGAAAAGAAGAAGGAAAATGG + Intergenic
1035898051 8:3426454-3426476 CAATTAATGGAAAAGGAAGCTGG + Intronic
1036717947 8:11144303-11144325 CATGAAATAAAGGAAGAAGCGGG + Intronic
1036741773 8:11369284-11369306 CATAAAATGAAGAGGCAAGTAGG - Intergenic
1037375540 8:18223703-18223725 TATTTAATCAAGAAAGAAGCAGG - Intergenic
1038484937 8:27928158-27928180 AATTAAATGAGGAAAGAGGCTGG - Intronic
1038587582 8:28804083-28804105 CAAAAAATCAAGAAAGAAGCTGG - Intronic
1038610326 8:29054825-29054847 CATCACAGGAAGAAGGAACCTGG + Intronic
1038986303 8:32814959-32814981 CATTAAATGAAGAAAAAAAATGG + Intergenic
1040387544 8:46923768-46923790 CAATAAATGGAAAAGAAAGCTGG - Intergenic
1041567311 8:59293529-59293551 CATTAAATGAAAAAGTAAACTGG - Intergenic
1041840361 8:62263344-62263366 TATTAAATGAAGAGGTAATCTGG + Intronic
1042097912 8:65238730-65238752 CAATAATTGAAGAAGGAATAAGG + Intergenic
1042198027 8:66250133-66250155 CAGTAAATAAAGAAGAAATCAGG - Intergenic
1042411606 8:68473027-68473049 CATTGTATGAAGGAGGAAGAAGG - Intronic
1042456641 8:69012814-69012836 CATAAAATGTAGAAGAAAGTGGG - Intergenic
1042521736 8:69719820-69719842 CACTACGTGAAGCAGGAAGCAGG - Intronic
1042835485 8:73075939-73075961 CATTAAATGAAACAGGAAAAAGG + Intronic
1043624753 8:82242973-82242995 CATTGGATGAAGCAGGAAGAAGG + Intergenic
1043704680 8:83333143-83333165 TATGAAATGAAGAAGGAAGAGGG + Intergenic
1045648538 8:104322337-104322359 CATTAAACCAAGAAGAAGGCGGG - Intergenic
1047067267 8:121298686-121298708 CAGTATATGAAGAAAGAAACTGG - Intergenic
1048204169 8:132402230-132402252 CATTAAGCCAAGAAGGAAGTTGG - Intronic
1049010891 8:139886687-139886709 TATGAAAGGAAGAAGGAAGGTGG - Intronic
1049116858 8:140696263-140696285 CATTAGAAGAAAAATGAAGCAGG + Intronic
1049628819 8:143639993-143640015 ACTTAAAGGAAGAAGGAAACAGG + Intronic
1050163356 9:2740448-2740470 CAGTTAGTGAAGAAGGAGGCAGG + Intronic
1050165079 9:2757094-2757116 AATCAAAGGAAGAAGGATGCAGG - Intronic
1050800426 9:9605381-9605403 CCTTAAATGAAGAAATAAGTAGG + Intronic
1051434409 9:17015879-17015901 AATTAAATTAAGGAGGCAGCAGG + Intergenic
1051655550 9:19378360-19378382 CCTTAAATAAAGAAGGTAGGAGG - Exonic
1053208601 9:36208712-36208734 CATTAACTGAAACAGGAAGGTGG + Intronic
1055178076 9:73345677-73345699 CATTAAGTAAAAAAGGAAGGTGG - Intergenic
1056554455 9:87677158-87677180 CAATAAATGGAGAAGGAGGGAGG - Intronic
1057422614 9:94924653-94924675 TAGTGAATGAAGAATGAAGCAGG + Intronic
1059072629 9:111154613-111154635 CATTCAATGACCAAGGAAGAGGG + Intergenic
1060397285 9:123325139-123325161 CATTGAAGGCAGAAGGAAACAGG - Intergenic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1185786831 X:2898009-2898031 GATTTAAAGAGGAAGGAAGCAGG - Intergenic
1185952174 X:4449477-4449499 CATTAAAGGAAGAGGGAAGTTGG + Intergenic
1188561807 X:31476987-31477009 CATTAACTGAAATAGGAAACAGG + Intronic
1189450693 X:41126430-41126452 TATAAAATGAAAAAGGAAGAGGG - Intronic
1190087689 X:47409943-47409965 TAAAAAATGAAGAAGGAGGCTGG - Intronic
1190306460 X:49085576-49085598 CATAAAAAGAAGCAGGAGGCTGG + Intronic
1190464443 X:50711979-50712001 CATTAAACAAATAAGGAAACAGG - Intronic
1190653201 X:52587642-52587664 AACTTAAGGAAGAAGGAAGCAGG + Intergenic
1194570614 X:95550392-95550414 CCTTAAATGAAGAAGGGGCCTGG - Intergenic
1195447852 X:104974605-104974627 CATCAAATAAAGAAGGAAGCTGG + Intronic
1195944509 X:110194388-110194410 AATTAAATGTGGAAGGAAGGAGG + Exonic
1196560034 X:117135254-117135276 CAGTAAGTGAAGAAGGAAAAGGG - Intergenic
1197883781 X:131196654-131196676 CATGGAAGGAAGAAGGAAGAGGG - Intergenic
1198014221 X:132592207-132592229 CATTAAATGCATCAGGAGGCAGG - Intergenic
1198626921 X:138586415-138586437 CAAAAAATAAAGAGGGAAGCAGG - Intergenic
1199538316 X:148928960-148928982 CATCAAATGAAGGAGGAACCTGG - Intronic
1200090634 X:153634295-153634317 CCTTCACTGAAGGAGGAAGCCGG - Intergenic
1201287568 Y:12392198-12392220 GATTTAAAGAGGAAGGAAGCAGG + Intergenic
1201427393 Y:13867561-13867583 TATGAAATGTAGAAAGAAGCAGG + Intergenic
1201738813 Y:17301731-17301753 AATTAAAGGAAGAGGGAAGTTGG + Intergenic
1202096134 Y:21249660-21249682 CAGTACATGAGGCAGGAAGCAGG + Intergenic