ID: 1095773403

View in Genome Browser
Species Human (GRCh38)
Location 12:45987270-45987292
Sequence AAGGACCCCTGAAATGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095773403 Original CRISPR AAGGACCCCTGAAATGAACA TGG Intronic
902784839 1:18726270-18726292 AAGGACCCCTGGAATGGGGAGGG + Intronic
903376772 1:22871334-22871356 GAGGCCCCCTGTAATTAACAGGG + Intronic
905651685 1:39661040-39661062 CAGAACCCCTGAGAGGAACAAGG - Intronic
906205980 1:43986670-43986692 CAAGACCCCTGACATGTACATGG - Intronic
909789167 1:79652254-79652276 AAGGAAACCTAAAATTAACAGGG - Intergenic
913230502 1:116737000-116737022 AAGGACTACAGATATGAACAAGG - Intergenic
913602296 1:120433563-120433585 AATGACTCCTGAAATTAAAATGG + Intergenic
914084752 1:144443074-144443096 AATGACCCCTGAAATTAAAATGG - Intronic
914190760 1:145408240-145408262 AATGACTCCTGAAATTAAAATGG - Intergenic
914363470 1:146957169-146957191 AATGACTCCTGAAATTAAAATGG + Intronic
914488207 1:148129965-148129987 AATGACTCCTGAAATTAAAATGG - Intronic
914501549 1:148251117-148251139 AAGGTCACCTGAATAGAACACGG - Intergenic
922111723 1:222565196-222565218 GAGGACCTCTGAATAGAACAGGG - Intronic
922625697 1:227039488-227039510 TAGGACCTCTGAAGTGAAAATGG - Intronic
923043881 1:230340243-230340265 AAAAAACCCTGAAATGGACATGG - Intronic
1064321326 10:14307878-14307900 AAGGACCCCAGTAAAGAACTAGG - Intronic
1064374578 10:14783994-14784016 AAGTACCGCTGAAATGTAAAGGG + Intergenic
1065998737 10:31084245-31084267 AAGGAACCCTGAAATAAAACAGG - Intergenic
1072225426 10:93364293-93364315 AAGAACTCCTCAAATTAACAAGG + Intronic
1072495632 10:95955874-95955896 AAGGACCCCTGTAAAAAGCATGG + Intronic
1076363529 10:129907146-129907168 AAGAACAACTGAAATGAATACGG + Intronic
1076502360 10:130947301-130947323 AAGAACCACTGAAAGGACCATGG + Intergenic
1076526210 10:131113723-131113745 AGGGACCCCTGAAAAGGACCAGG + Intronic
1083909228 11:65696211-65696233 AAGAAACCCAGAAATGAGCAGGG + Intergenic
1084268700 11:68017911-68017933 AAGGACTCCTGAGAAGAGCAGGG - Intronic
1085324806 11:75598373-75598395 TAGGAGCCCTGAACTGAGCAGGG + Intronic
1086042931 11:82500629-82500651 AAGCAGCCCTGTAATGTACATGG - Intergenic
1086897613 11:92331926-92331948 AAGGAACCCTAAACTGAAAAAGG - Intergenic
1088474304 11:110219357-110219379 AATGACCGCTGAAAAGAACATGG + Intronic
1088537281 11:110875032-110875054 AAAGACCCATGAAGTGAAGATGG + Intergenic
1089140251 11:116278545-116278567 AGGGACCCCAGAAATCCACAGGG + Intergenic
1089190215 11:116648318-116648340 AAGAACCCCTGATCTGGACAGGG + Intergenic
1089216854 11:116839356-116839378 AAGGACCCCTGTGATGACAATGG - Intergenic
1089343717 11:117776989-117777011 AGGGTCCCCAGAAAGGAACAGGG + Intronic
1091157872 11:133390540-133390562 AAAGACCACTGAAATGAGAAAGG + Intronic
1093379189 12:18470762-18470784 GAGAACCACTGACATGAACATGG - Intronic
1094027808 12:25977161-25977183 AAGGAAGCCTGAAACAAACAGGG - Intronic
1095431038 12:42134865-42134887 AAGGACTCCTGAGAAGAAGATGG - Intronic
1095773403 12:45987270-45987292 AAGGACCCCTGAAATGAACATGG + Intronic
1097191341 12:57220973-57220995 AAGGACCAGAGAAATGAAGATGG - Intronic
1097615091 12:61874791-61874813 AAAGACACCTGAAATGATCAAGG + Intronic
1098584238 12:72137390-72137412 AAGGATCCCTAAAAAGAAAATGG - Intronic
1101012734 12:100467721-100467743 AGGGGACACTGAAATGAACAAGG - Intergenic
1103324089 12:120108911-120108933 AAGGACCCTTGAGATCATCAGGG + Intronic
1106473321 13:30077067-30077089 AAGGACCCCTGAGATGACACTGG + Intergenic
1111382003 13:87468191-87468213 AAGTACAACTGAAATAAACATGG - Intergenic
1111725711 13:92005508-92005530 AAGGAACCCTGAAAGGAGAAGGG - Intronic
1111991605 13:95122608-95122630 AAGGCCCCCTGATGGGAACAGGG - Intronic
1113220090 13:108090344-108090366 AGGGTCTCCTGAAATGAACGAGG + Intergenic
1114520101 14:23328376-23328398 CAGGACCCCTGCAATGATGATGG - Intergenic
1116528170 14:45933458-45933480 AAAGACACCTTAAAAGAACAAGG + Intergenic
1117246150 14:53888821-53888843 CAGGACTGCTGAAGTGAACAGGG - Intergenic
1118020259 14:61705210-61705232 AATGACCACTAAAAGGAACAAGG - Intronic
1118656634 14:67957534-67957556 AAGGACCAAAGAAATGAAGATGG + Intronic
1121174322 14:91879403-91879425 CAGGACACCTGAACTGGACAAGG + Intronic
1126845657 15:52758569-52758591 AGAGACCCCAGAGATGAACATGG - Intronic
1127269430 15:57387449-57387471 AATGACCCTTGAAATGAATGTGG + Intronic
1127342438 15:58061982-58062004 AAGCACCCCTGTTAGGAACATGG + Intronic
1127534306 15:59875459-59875481 AAGAACCCCTGAAATAAGCCCGG - Intergenic
1133422881 16:5662253-5662275 AAGGAGTCCTGAAATTAAAATGG - Intergenic
1138673304 16:58632543-58632565 AAGGCCCCCTAAACAGAACAAGG + Intergenic
1138870239 16:60874497-60874519 AAGGGCCCATGAACTAAACATGG + Intergenic
1141249726 16:82344323-82344345 AGGCATCCCTGAATTGAACACGG - Intergenic
1144900520 17:18584809-18584831 AAGTACCCCTAAAATTCACAGGG + Intergenic
1145131926 17:20360872-20360894 AAGTACCCCTAAAATTCACAGGG - Intergenic
1150206790 17:63415202-63415224 AAGGAACTTTGAAATGAGCATGG + Intronic
1150319891 17:64204025-64204047 ATGAACCACTGAAATGACCAAGG + Intronic
1150913946 17:69417078-69417100 AAGTACATCTGGAATGAACATGG + Intronic
1152939359 17:83159703-83159725 AAGAACCCCAGAAATCTACATGG - Intergenic
1156103037 18:33621604-33621626 AAGGAAGACTGAAAAGAACAAGG + Intronic
1157479559 18:48044712-48044734 CAGGACCCATGAAACGAACTGGG + Intronic
1157973009 18:52292740-52292762 AAGAACACCTCAAATGAGCATGG - Intergenic
1158025611 18:52893511-52893533 AATGACCTTTGAAATGAATAGGG + Intronic
1159864850 18:73691720-73691742 AAGAACGCCTCAAATGAGCATGG + Intergenic
1162192284 19:8956420-8956442 AATGACCACTGTCATGAACAAGG - Exonic
1164869099 19:31628587-31628609 AAGAAGCCCAGAAAGGAACAAGG - Intergenic
925523672 2:4776149-4776171 AAGGAAACCTGAAAAGAAAAGGG + Intergenic
926359697 2:12074619-12074641 AAGAAGCCCTGAAATGTGCAGGG - Intergenic
928065686 2:28162265-28162287 AAGGGCACCTGAAATGTACATGG + Intronic
929236416 2:39610037-39610059 TAGGAGCCCTGAGGTGAACATGG + Intergenic
929541890 2:42829111-42829133 CATGACCCCTGAAATGAATTGGG - Intergenic
931874480 2:66496931-66496953 AACCACCCCTGAAATGTACAAGG - Intronic
938007938 2:127803801-127803823 AAGGAGCCCTCAAATTAACTGGG + Intronic
941043839 2:160650886-160650908 AGGGACTCATGAAATGAAAAAGG - Intergenic
941345167 2:164359536-164359558 AAGGACACCTGTGATGGACACGG - Intergenic
942443372 2:176059394-176059416 AACTTCCCGTGAAATGAACATGG - Intergenic
943183442 2:184574562-184574584 AGGGAACCCTAAAATGAAGAGGG + Intergenic
943212180 2:184981088-184981110 AAGCAACTCTGAAATGCACAGGG + Intergenic
943919520 2:193685835-193685857 AAAGAAACCTGAAATGAAAATGG - Intergenic
945104324 2:206295051-206295073 ATGGACCTCTGAAGTCAACATGG + Intronic
948943745 2:241209215-241209237 AAGGAACACTGGAAGGAACAAGG + Intronic
1173083992 20:39897767-39897789 AAACATCCCTGAAATGACCAGGG - Intergenic
1174448755 20:50607605-50607627 AGGGGCCCCTGAAGTGTACAGGG - Intronic
1174563195 20:51445799-51445821 AAACACCCGGGAAATGAACATGG + Intronic
1176614838 21:9018380-9018402 CAGGAACCCAGAACTGAACAGGG - Intergenic
1177440727 21:21120572-21120594 CAGAGCCCCTGAAATGAAAAAGG + Intronic
1178385147 21:32143019-32143041 AAGGTCCCCTGAAAAGTCCACGG + Intergenic
1178808199 21:35857089-35857111 ACGGACCCCTCAAATCCACATGG - Intronic
1180627420 22:17203392-17203414 AAGGAAACCTGAAATGGACTGGG - Intronic
1182665116 22:31952482-31952504 AAGGAAACATGAAATGAAGATGG - Intronic
1185336541 22:50273101-50273123 AAGGATCCCTGAAATGACATTGG - Intergenic
950793614 3:15493269-15493291 AAGTAGCCCTGAATGGAACATGG - Intronic
952384223 3:32827727-32827749 AAGGGCCCCTGGAATTCACAGGG - Intronic
953641901 3:44716066-44716088 AATATCCCCTGAAATGTACATGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
960717393 3:120590417-120590439 AAGCTCCCCTGAAAAAAACATGG + Intergenic
962354369 3:134681109-134681131 GAGGACCCCTTATAGGAACAGGG - Intronic
963573918 3:147034671-147034693 AAAGACCTCTCACATGAACAAGG + Intergenic
964726444 3:159818767-159818789 AAGGACCTGTGATATGACCATGG - Intronic
966680483 3:182637256-182637278 AAGGACAAATGACATGAACATGG + Intergenic
966941789 3:184752542-184752564 AAGGACCCCTGAGATCATCTAGG - Intergenic
967681694 3:192371085-192371107 AAGTAGACCTGGAATGAACATGG + Intronic
973978792 4:56288825-56288847 AAGTAGCACTGCAATGAACATGG - Intronic
976830716 4:89310543-89310565 AAGGACCCCTGTAATGACATGGG + Intergenic
977544069 4:98354379-98354401 AAGAACAACTAAAATGAACAAGG - Intronic
979004862 4:115281175-115281197 AAATAACCCTGTAATGAACATGG - Intergenic
981129338 4:141141115-141141137 AAGGACACTGGAAAGGAACAGGG + Intronic
982381239 4:154751035-154751057 AATGAACACTCAAATGAACAAGG - Exonic
982923195 4:161303047-161303069 ATGAACCTCTGAAATGAAAATGG - Intergenic
983005613 4:162481039-162481061 AAGTAATGCTGAAATGAACATGG - Intergenic
984784722 4:183556980-183557002 GAGGTCACCTGCAATGAACAGGG - Intergenic
985615953 5:922209-922231 AAGGACCCCTGGGCTGACCAGGG - Intergenic
988062832 5:26195393-26195415 AAGTACCCCTAGAAAGAACAAGG - Intergenic
988127903 5:27065818-27065840 AATGACTACTGAAGTGAACATGG + Intronic
991164889 5:63554202-63554224 AAGAACACCTAAAATGAGCATGG + Intergenic
993775757 5:91993577-91993599 AAGGAACCCTGGAATGTTCATGG + Intergenic
994006965 5:94849050-94849072 AAGGATTCCTGAAATAAACAAGG + Intronic
994784138 5:104133981-104134003 AATGACCCCAGGAATGACCAAGG - Intergenic
1000312528 5:160058819-160058841 GAGGAGCTCTGAGATGAACAAGG - Intronic
1004401325 6:15291497-15291519 AAGGAGCGCTTAAATGAAGAAGG + Intronic
1006818410 6:36870273-36870295 AAGGGCCCTTGAAATGAGTAAGG + Intronic
1013298961 6:108785442-108785464 AAGAAACCCAGAAATGAACCAGG - Intergenic
1013437544 6:110126321-110126343 AATGACCACTGAATGGAACAAGG + Intronic
1016159436 6:140859523-140859545 AAAGAACCCTGAGAAGAACAAGG + Intergenic
1016904073 6:149131773-149131795 GAGGAACCCTGACATGAACCAGG + Intergenic
1017155651 6:151320522-151320544 AAGGACCCTGGGAATGGACAGGG - Intronic
1023083320 7:36545791-36545813 CAGCATCCCTGAAACGAACATGG - Intronic
1026780258 7:73261524-73261546 AAGTACCCCTGAAATGAGGCTGG - Intergenic
1026900666 7:74035349-74035371 AGGGACCCCTGAAAGGAAACAGG - Exonic
1027021117 7:74814942-74814964 AAGTACCCCTGAAATGAGGCTGG - Intronic
1027066909 7:75130982-75131004 AAGTACCCCTGAAATGAGGCTGG + Intronic
1028855228 7:95584439-95584461 AATGACACCTGAAATGCATATGG - Exonic
1029315173 7:99705401-99705423 ATAGAACCCTGAAATGAAGACGG - Exonic
1030825788 7:114156016-114156038 AAGAACGCCTCAAGTGAACATGG - Intronic
1030924282 7:115431984-115432006 AGGGATCACTGAAATGAAGAAGG + Intergenic
1031353132 7:120760088-120760110 AAGGATCCCTGGAATGATCTGGG + Intergenic
1032159731 7:129501483-129501505 AATCACCCCTTAAAAGAACAAGG + Intergenic
1033930246 7:146510482-146510504 AAGCAACCCTAAAATGTACATGG - Intronic
1040289020 8:46114906-46114928 AAGGACCCCAAAAGTGAAAATGG - Intergenic
1040311022 8:46236929-46236951 AAGGACCCCACAAGTGAAAAAGG + Intergenic
1040328930 8:46376152-46376174 AAGGACCCCAGAAGAGAAAATGG + Intergenic
1040338282 8:46427192-46427214 AAGGTCCCCAGAAGTGAAAACGG + Intergenic
1040338986 8:46430394-46430416 AAGGTCCCCAGAAGTGAAAACGG + Intergenic
1040339509 8:46433359-46433381 AAGGACCCCACAAGTGAATATGG + Intergenic
1040568471 8:48587631-48587653 AGGGGCCCCTCAAGTGAACAGGG + Intergenic
1043411612 8:80003612-80003634 AAGCACCAGTGAAATGAACCCGG - Intronic
1043861035 8:85317336-85317358 ACGGACCCATGAGATGAACTTGG - Intergenic
1050605965 9:7301414-7301436 GAGGTCCCCAGAAGTGAACAGGG - Intergenic
1057282392 9:93722160-93722182 GAGGGCCACTGAAATGAACCCGG - Intergenic
1186438324 X:9563178-9563200 AAAAACACCTAAAATGAACAAGG - Intronic
1190819759 X:53962380-53962402 AATGACCACTGAGTTGAACATGG - Intronic
1192847265 X:74919285-74919307 AAGAACCCCTGAAATGATTCAGG - Intronic
1194570620 X:95550399-95550421 CAGAACCCCTTAAATGAAGAAGG - Intergenic
1197206027 X:123791505-123791527 AAGGAATCCTGAACTGAGCAGGG - Intergenic
1201295522 Y:12459991-12460013 AAGGCTCTCTGAAATTAACAGGG + Intergenic