ID: 1095777632

View in Genome Browser
Species Human (GRCh38)
Location 12:46026740-46026762
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 8, 1: 25, 2: 54, 3: 68, 4: 213}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095777632_1095777636 30 Left 1095777632 12:46026740-46026762 CCTACAGCATGGTGCTGCTGAAC 0: 8
1: 25
2: 54
3: 68
4: 213
Right 1095777636 12:46026793-46026815 GAGTTACAGAGCAGTTTCCAGGG No data
1095777632_1095777635 29 Left 1095777632 12:46026740-46026762 CCTACAGCATGGTGCTGCTGAAC 0: 8
1: 25
2: 54
3: 68
4: 213
Right 1095777635 12:46026792-46026814 TGAGTTACAGAGCAGTTTCCAGG No data
1095777632_1095777634 5 Left 1095777632 12:46026740-46026762 CCTACAGCATGGTGCTGCTGAAC 0: 8
1: 25
2: 54
3: 68
4: 213
Right 1095777634 12:46026768-46026790 CTCTGGTTTAGTATCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095777632 Original CRISPR GTTCAGCAGCACCATGCTGT AGG (reversed) Intergenic
900393165 1:2442649-2442671 GTGCAGAAGCAGCATGGTGTGGG + Intronic
900622346 1:3593217-3593239 GTTCAGCCGCTCCCCGCTGTGGG - Intronic
901496224 1:9623764-9623786 CTTCAGCAGCCACCTGCTGTTGG + Intergenic
901768915 1:11520777-11520799 GTCCAGCAGCACCTGGATGTTGG - Exonic
901799131 1:11697348-11697370 GATCAGCAGCTCCATGTTCTGGG + Intronic
901842602 1:11963603-11963625 GATCAGCAGCCGCAGGCTGTTGG - Exonic
903219392 1:21860383-21860405 GTTCACCAGCACCCTGCGTTGGG - Intronic
904012788 1:27399346-27399368 GCTGAGCAGCTCCAGGCTGTGGG - Intergenic
904275289 1:29379820-29379842 ATTAAGCAGCACCATGCTGTAGG - Intergenic
904426565 1:30427628-30427650 GTTCAGCAGCACCACATTGTAGG + Intergenic
905043107 1:34976602-34976624 GCTCAGCAGCGCCAGGCTGAGGG + Intergenic
905435927 1:37955115-37955137 GTTTAGCAGCACCAATCTGAGGG + Intergenic
907982675 1:59499363-59499385 GTCCAGCAAATCCATGCTGTAGG - Intronic
908660915 1:66434349-66434371 GCTGAGCAGGACCATCCTGTAGG + Intergenic
909460608 1:75908955-75908977 GTACAGCAGCACCATGCTAGAGG - Intronic
911753025 1:101520571-101520593 GTTCAACAGCACCATGTTATAGG - Intergenic
911764104 1:101653712-101653734 GTTTAGCAGCATAATACTGTAGG - Intergenic
912016288 1:105040679-105040701 ATTCGGCAGCACCATGTTGAAGG + Intergenic
912589540 1:110802399-110802421 AGTCAGCAGCAGCATGCTATAGG + Intergenic
912640665 1:111342537-111342559 GTTCAGCAGTGCAAAGCTGTAGG - Intergenic
912731344 1:112109053-112109075 GTTGAGCAGCACCATGCAGTAGG - Intergenic
915880371 1:159664796-159664818 GTTCAGCAGCACCATGCAGTAGG - Intergenic
916468373 1:165094930-165094952 GTTCAGCAGCACCACAGCGTAGG + Intergenic
918229868 1:182518431-182518453 GTTCAGCAACATCACACTGTAGG - Intronic
918621033 1:186606102-186606124 GTTCAGCAGCACCGGGCTCTAGG - Intergenic
918969559 1:191396971-191396993 TTTCAGCAGCACCCCGCTCTTGG - Intergenic
921495400 1:215834565-215834587 GTGAAGCAGCATCATGATGTCGG - Intronic
921942195 1:220853730-220853752 GTTCAGCAGCACCATGCTGTAGG - Intergenic
922504912 1:226120861-226120883 GTTCAGCTGGAGCATGCTGCCGG - Intergenic
923271575 1:232359568-232359590 GTTCAGCAGCGACTTGCTGAGGG + Intergenic
923724916 1:236497395-236497417 GGTGCACAGCACCATGCTGTGGG - Intergenic
923937656 1:238781381-238781403 GTTCAGCACCATCATGCTGTAGG - Intergenic
923949507 1:238932310-238932332 TTTCAGCAGCACCATGCCCAAGG - Intergenic
1064326888 10:14359554-14359576 ATTCACCATAACCATGCTGTTGG + Intronic
1065496570 10:26335410-26335432 GTTTGGCAGCACCATGCTGTAGG - Intergenic
1066629781 10:37447846-37447868 ATTCACCATAACCATGCTGTTGG - Intergenic
1068007249 10:51406170-51406192 GTTCTGCAGCAGCAGGCAGTGGG - Intronic
1069804693 10:71112980-71113002 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1070040357 10:72772204-72772226 GTTCAGCAGCACCATGCTGTAGG + Intronic
1070584859 10:77756487-77756509 GTTCAGTAGCACCACACTGTAGG + Intergenic
1070971215 10:80569033-80569055 TTTCAGCAGCACCCTGCTTCTGG + Intronic
1072054886 10:91745224-91745246 ATTCAACAGCACCATGCCGTAGG + Intergenic
1072772096 10:98150713-98150735 GTTCAGCAGCACCACGCTGTAGG - Intronic
1074673118 10:115818253-115818275 GCTCAGCAGCTCCATGCTTCTGG - Intronic
1074893796 10:117757439-117757461 GTTCAGCAGCCCAAGGCTGAGGG - Intergenic
1075206860 10:120456449-120456471 GTTCAGCAGCCCCAAGCTGCTGG + Intergenic
1075728417 10:124622468-124622490 GGTCAGCCTCTCCATGCTGTAGG + Exonic
1076238505 10:128884177-128884199 GTTCAGCGGCATCAGGCTGAAGG - Intergenic
1076926329 10:133490001-133490023 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1078361318 11:10670072-10670094 GATCAGCAGCACCTTGTTTTTGG + Intronic
1080192481 11:29568804-29568826 GTTCAGCAGCACTATGCTGTGGG + Intergenic
1080716995 11:34812505-34812527 GTTCAGCAGCACCATACTGTAGG + Intergenic
1080873594 11:36257959-36257981 GTCCAGCAGCCCCTTGCTTTTGG - Intergenic
1081040292 11:38201496-38201518 ATTCAGCAGCATCATGCTGTAGG + Intergenic
1082162827 11:48902167-48902189 AGCCAGCAGCACCATGCTGGTGG + Intergenic
1082888830 11:58116696-58116718 GTTCAGCTTCACAATGCTGATGG + Intronic
1082935428 11:58652094-58652116 GCTCAGCAGCACCATGCTATAGG - Intronic
1084365294 11:68693585-68693607 GGTCAGCAGCACAAAGGTGTCGG + Intergenic
1084665498 11:70574077-70574099 CTCCATCAGCACCATGCTGGGGG - Intronic
1085457763 11:76674823-76674845 TTTCTGCAGCACCAGGCTGCTGG + Intergenic
1086035960 11:82414702-82414724 TTTTAGCAGCACCATGCTGTAGG + Intergenic
1086552942 11:88073284-88073306 GTTCAACAGAACCATGCTACAGG + Intergenic
1087700239 11:101429244-101429266 CTTCAGCAGGATCATGCTATAGG - Intergenic
1092671570 12:10867713-10867735 GTTCAATAGCACCATGCTTTAGG - Intronic
1092941391 12:13410465-13410487 GTTTAGCAGCACCATGCTGTAGG + Intergenic
1093142663 12:15527549-15527571 GTTCAGCAGCACCATACTGTAGG + Intronic
1093166088 12:15805508-15805530 AATCAGCAGCACCATGCAGCAGG + Intronic
1094471694 12:30807462-30807484 CTTCAGCAGCACCATGCTGTAGG + Intergenic
1095777632 12:46026740-46026762 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1097646236 12:62237908-62237930 GTTCAGCAACACCAAGATGTAGG - Intronic
1097786700 12:63768041-63768063 GTGCAGCAGCACCCAGCTGAGGG + Intergenic
1099434551 12:82627897-82627919 GTTCAGCAGCACCGCACTGTAGG + Intergenic
1100100062 12:91092201-91092223 GTCAAGCAGCATCATTCTGTAGG - Intergenic
1100804463 12:98266800-98266822 GTTCAGGAGCCCTATGCTGTAGG + Intergenic
1101364359 12:104058000-104058022 GTTCAGCAGCACCACACTGTAGG - Intronic
1101379413 12:104201542-104201564 TTTCAGGAGCATGATGCTGTAGG - Intergenic
1101792611 12:107941592-107941614 GTTCAGCTGCACCATGCAGAAGG + Intergenic
1102619455 12:114182507-114182529 GGTCAGCACCAACTTGCTGTAGG + Intergenic
1104209577 12:126675632-126675654 GTTCAGCAGCAGCAACATGTAGG + Intergenic
1104559238 12:129829011-129829033 GTTCAGAAGCACAGTGGTGTTGG - Intronic
1104795575 12:131514822-131514844 ATTCAGCCGCACGATGCCGTAGG + Intergenic
1105968388 13:25405118-25405140 GTTCAGCAGCAAGAGGCTGTTGG + Intronic
1105981963 13:25526677-25526699 GCTTAGCAGCACCATGCTGTAGG - Intronic
1106859770 13:33893162-33893184 GTTCAGCAGCACCACACCATTGG + Intronic
1106904881 13:34395402-34395424 GTTCAGCAGCACCACTCTACAGG + Intergenic
1107518299 13:41153545-41153567 GTGCAGCAGCTCTATGCCGTGGG - Intergenic
1107793841 13:44030002-44030024 GCTGAGCAGCACCATGTGGTTGG + Intergenic
1107985879 13:45775752-45775774 CCTCATCAGCACCAAGCTGTGGG + Intergenic
1108769413 13:53680266-53680288 GTTCAGCAGTACCATGCTGTAGG - Intergenic
1109362711 13:61316845-61316867 GTTCAGCAGCACCATGTGGTAGG - Intergenic
1113601911 13:111575558-111575580 CCTCAGCAACACCATGCGGTTGG + Intergenic
1115279675 14:31647575-31647597 GTTCAGCAGCACCACATTGTAGG - Intronic
1116514007 14:45784434-45784456 GTTTAGCAGCCCTATGCTGTAGG - Intergenic
1116745597 14:48814591-48814613 GTTCAGCAGCACTATGCTGCAGG + Intergenic
1117618067 14:57554473-57554495 GTTCAGCAGCTCCAAGCTATAGG - Intergenic
1118547346 14:66906183-66906205 GTTCAGCAGTACCACGCTGTAGG - Intronic
1119684258 14:76618514-76618536 GTTCTGCGGCATCATGTTGTAGG + Intergenic
1119899866 14:78250534-78250556 TGTCAGCAGCCCCATGCTCTTGG - Intronic
1125365537 15:38911479-38911501 GTTCAGCAGCAGTATGGTGTAGG - Intergenic
1126269184 15:46792879-46792901 GTTCAGTAACACTATGCTGCAGG + Intergenic
1126280953 15:46948740-46948762 GTTAAGTAGGACCATGATGTTGG - Intergenic
1126815858 15:52452561-52452583 GTTCAGCAGTATCATACTGTAGG + Intronic
1126990410 15:54368630-54368652 TGTTAGCATCACCATGCTGTGGG - Intronic
1127188079 15:56500851-56500873 GTTCAGCAGCATCGTGCTGTAGG + Intergenic
1127252324 15:57253310-57253332 GTGCTGCGGAACCATGCTGTGGG + Exonic
1127521390 15:59746468-59746490 GTTGAGCCCCAGCATGCTGTTGG + Intergenic
1127678538 15:61269809-61269831 TTTCAACAGCCCCTTGCTGTGGG - Intergenic
1127719915 15:61689237-61689259 GCTTAGCAGCACCATGCCATAGG - Intergenic
1127739844 15:61892261-61892283 GTTCAGCAGCACAACACTGTGGG + Intronic
1128964884 15:72048834-72048856 ATTCATGAACACCATGCTGTTGG + Intronic
1129417257 15:75392520-75392542 GTTAAGAAGCACAATGGTGTTGG - Exonic
1129601095 15:76998832-76998854 GTTCAGATGCACGCTGCTGTAGG + Intronic
1129954015 15:79617126-79617148 GTTCAGCAGCTCCAGGATGCAGG + Intergenic
1130172966 15:81535717-81535739 GTTCAGCAGCTCCAGGCTGTAGG + Intergenic
1132224282 15:100128409-100128431 GTCCAGCAGCATCGTCCTGTGGG - Intronic
1132397394 15:101483928-101483950 GTCCAGAAGCACCATGCGGTAGG + Intronic
1139047175 16:63076056-63076078 GTTCAGCAGCACCACAGTGTAGG - Intergenic
1141568065 16:84916717-84916739 TTTCAGCAGCTCCAGGCTGCAGG + Intronic
1141708066 16:85680307-85680329 ATTCAGCAGCGCCATTCAGTGGG + Intronic
1141748817 16:85944737-85944759 GATCAGCAGGTCCATCCTGTGGG + Intergenic
1141783482 16:86181599-86181621 GTTCAGCAACAGCAGGCTGAGGG - Intergenic
1141858186 16:86699176-86699198 GTTCATCAGCACTAAGCTATGGG - Intergenic
1143732879 17:8890894-8890916 GTTCAGCAGCAGCACGGTGCTGG + Exonic
1144654193 17:17025039-17025061 TTTCAGCAGGACCATGTGGTTGG - Intergenic
1144853294 17:18254783-18254805 GTTCAGCACCAGCATGTTCTTGG + Exonic
1145795361 17:27652354-27652376 GATGAGCAGCAGCATGCTGAAGG + Intergenic
1147323721 17:39660483-39660505 GTTCCACAGCACCATCCTCTCGG - Exonic
1148142037 17:45335850-45335872 TCTCAGCAGATCCATGCTGTTGG - Intergenic
1148403438 17:47388031-47388053 GTTCAGCAGTACCACACTGTAGG - Intronic
1149061664 17:52429826-52429848 GTCCATGAGCACCATGCTGCAGG + Intergenic
1149636273 17:58172488-58172510 GTCCAGCAGCACCATGCTGTAGG + Intergenic
1149949355 17:60968732-60968754 GTTCAGCAGCACCATGTAGTAGG - Intronic
1151756690 17:76079306-76079328 GTTCAGCATTACCTTGCTGTTGG + Exonic
1151897877 17:76992511-76992533 GCTCAGCAGAACCTTGCTTTAGG - Intergenic
1152607785 17:81301743-81301765 GTGCAGCAGACCCATGCTCTTGG - Intergenic
1153722606 18:7922248-7922270 GTTAAGCAGCACCTCACTGTAGG - Intronic
1154216802 18:12421305-12421327 GTGCAGCAGCACTATGCTCCCGG - Intronic
1155011917 18:21787319-21787341 GTTCAGCAGCACTATACTGCAGG - Intronic
1155113702 18:22742621-22742643 GTTCAGCAGCACCACACTGTAGG + Intergenic
1155270285 18:24134933-24134955 GTTTTGCAACACCATCCTGTAGG + Intronic
1155978007 18:32152761-32152783 GTTCAGCAGCACCACACTGTAGG - Intronic
1157813134 18:50711901-50711923 GATCACCAGTACCATGTTGTGGG + Intronic
1157887240 18:51380692-51380714 GTTCAGCTGGAACATGATGTTGG + Intergenic
1157917472 18:51680319-51680341 GTTCAGCACCACCAGGCTGTAGG + Intergenic
1159705663 18:71683378-71683400 GTCCAGTAGTTCCATGCTGTAGG + Intergenic
1159837209 18:73352708-73352730 GTTCAGCAGCAACACTCTGCAGG - Intergenic
1162265753 19:9572560-9572582 GTTCAGGAGCACCATACTGTAGG + Intronic
1162997935 19:14348340-14348362 GTTCAGCAGCTCCATGCCTGGGG - Intergenic
1163065129 19:14786732-14786754 GTTCAGCAGCTCCATGCCTGGGG + Intergenic
1163368642 19:16889792-16889814 GTTCATCAGCAGCATGGTGGAGG - Exonic
1164726507 19:30469072-30469094 GGTCAACAGCACCATGTTGCAGG - Intronic
1165566185 19:36730293-36730315 GTTCAGCAGCAGCATGCTGTAGG + Intronic
1166623122 19:44322856-44322878 GTTCAGCATCACTATACTGTAGG - Intergenic
1166974736 19:46599313-46599335 GTTCGTTAGCACCATGCTGTGGG - Intronic
925418675 2:3692707-3692729 GTTCAGCAACACCATGTTGTAGG - Intronic
926132469 2:10312937-10312959 GTTGAGAAGCACCATGATGTTGG - Intronic
926610848 2:14945083-14945105 GTTCAGCAGCACCAAGCTGCCGG + Intergenic
926875397 2:17471139-17471161 GTTCAGCAGCACAATGCTGTAGG - Intergenic
927523830 2:23719904-23719926 GTTAAGCAGCGCCATGCTGTAGG + Intergenic
927854442 2:26519076-26519098 CTTCTGCAGCACCATGCGGAAGG + Exonic
928477194 2:31640689-31640711 GTTCAGTGGCACTATGCTGCAGG - Intergenic
930032754 2:47068590-47068612 GTTCTGCAGGCCCATGGTGTGGG + Intronic
930858753 2:56047228-56047250 GTTCAGCAGCACCTTGCTGGTGG + Intergenic
931542067 2:63340350-63340372 ATTCAGCAGCACCACACTTTAGG - Intronic
932451885 2:71816043-71816065 CTCCAACAGCACCATTCTGTTGG - Intergenic
932609056 2:73185187-73185209 GTTCAGCAGCACCATCCTCTTGG - Intergenic
932688175 2:73891295-73891317 GTGCAGCAGCAGCATGATATGGG - Intergenic
933460214 2:82573659-82573681 ATTCAGCTGTACCATGCTGTAGG - Intergenic
936851567 2:116905229-116905251 ATTAAGCAGCACCATCCTGTAGG - Intergenic
939080410 2:137654297-137654319 GTTCAGCAGTACCACGCTGTAGG - Intronic
939388782 2:141538688-141538710 GTGCAGCAGCACAATGATCTTGG + Intronic
939847586 2:147267534-147267556 ATTCAGCAGCACCACACTGTAGG - Intergenic
940532013 2:154889850-154889872 GTTCGGCAGCACCACATTGTAGG - Intergenic
941360610 2:164546856-164546878 GTTCAGCAGCACCACACGATAGG + Intronic
941477870 2:165970774-165970796 GCTCACCAGCACCATGCTGTAGG + Intergenic
941589913 2:167406761-167406783 ACTCAGCAACACCATGCTGTCGG + Intergenic
943102479 2:183505172-183505194 GTTCAGCAGCATCATGCTGTTGG - Intergenic
943602563 2:189939210-189939232 TTTCAGTGGCACCATGCTGTAGG + Intronic
943659505 2:190543260-190543282 GTTCATCAGCACTGTGCTGTCGG - Intergenic
944277691 2:197858002-197858024 GTTCAACAGCCCCATGATGTAGG - Intronic
944999078 2:205329599-205329621 GTTAAGAAGCAACATGCGGTAGG + Intronic
945676680 2:212863470-212863492 GTTCAGCAGCATCACCCTGTAGG - Intergenic
947305386 2:228740634-228740656 GTACAGCAGCACCATGCTCTAGG - Intergenic
948739962 2:240039849-240039871 GTTCAGCAGCACCATGCTGTAGG - Intergenic
1169604576 20:7302379-7302401 TTTATGCAGCTCCATGCTGTTGG + Intergenic
1170863492 20:20130774-20130796 GTTCAGCAGCACCACACTGTAGG - Intronic
1171427090 20:25056130-25056152 GTTCAGAAGGTCCTTGCTGTTGG + Intronic
1171508347 20:25658171-25658193 GTTCACCAGCACCATGCTGTAGG - Intergenic
1174271311 20:49371373-49371395 GGCCAACAACACCATGCTGTTGG + Exonic
1175540607 20:59745397-59745419 GTTCACCAGCAAGATGCTCTGGG + Intronic
1175908591 20:62393915-62393937 GTCCAGGAGCACCTGGCTGTGGG + Intronic
1176220251 20:63966194-63966216 GGTCAGCAGCACCATTTTGCAGG + Exonic
1176664922 21:9677543-9677565 ATTCCTCAGCACCATGCAGTTGG - Intergenic
1177104841 21:16943030-16943052 GTTCAGCGGCACTATACTATAGG - Intergenic
1177723364 21:24936160-24936182 GAGAAGCAGCACCATGCTCTGGG + Intergenic
1178359871 21:31939854-31939876 GTTAAGCAGAACCAGGGTGTGGG - Intronic
1179451075 21:41468835-41468857 GTTCAGCAGAACCAAGCCGTTGG - Intronic
1180575980 22:16774916-16774938 GTGCAGCAGTACCATGAGGTAGG - Intergenic
1180607975 22:17075547-17075569 GTTAAGCAGCACCATGTGGTAGG - Intergenic
1181651640 22:24262172-24262194 GGTCAGCACTGCCATGCTGTGGG - Intergenic
1184150628 22:42636332-42636354 GTCCAGTAGTACCAGGCTGTGGG + Intronic
1184327470 22:43800124-43800146 TTTCAGCAGTCACATGCTGTAGG + Intronic
1184922558 22:47615700-47615722 GTCCAGCATCTCCAGGCTGTGGG + Intergenic
950081069 3:10222491-10222513 GCTCAGAAGCTCCATGCTGAGGG + Intronic
950103313 3:10371851-10371873 GATCAGCAGCTCCATGGTCTTGG + Exonic
952884899 3:38006296-38006318 GCCCATCAGGACCATGCTGTCGG - Intronic
952972684 3:38662633-38662655 GTTCAGCAGCAACACACTGTAGG + Intergenic
955267832 3:57464298-57464320 ATTCTGCAGCACCACACTGTAGG + Intronic
955395226 3:58552470-58552492 GTTCAGCAGCACCATGCTGTAGG - Intergenic
957777482 3:84772546-84772568 GTTTAGTAGAACCATACTGTTGG + Intergenic
958825627 3:99026825-99026847 GTTCAGCAGAACTGTCCTGTAGG + Intergenic
959679826 3:109082040-109082062 GTTCAGCAGCATCACACTGCAGG + Intronic
959766460 3:110036142-110036164 GTTCAGCCACACTATGCTATAGG - Intergenic
959846173 3:111036151-111036173 GTGCTGCAGCACCATGCAGAGGG - Intergenic
960749171 3:120927326-120927348 GTTCAGCAGTATCATGCTATAGG - Intronic
962200731 3:133399382-133399404 GTTCATCAGCTGCTTGCTGTTGG - Intergenic
962247860 3:133812289-133812311 GTTCATCACCACCATCTTGTGGG - Intronic
962497928 3:135961580-135961602 GTTCAGCAGCAACATGATGTAGG - Intergenic
962763309 3:138538286-138538308 GTTCAGCAGCACCACACTGTAGG + Intronic
963819267 3:149869996-149870018 ATTCAGTAGCACCATACAGTAGG - Intronic
964612206 3:158626975-158626997 GATCAGCTGCAACATGTTGTCGG - Intergenic
964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG + Intergenic
965867386 3:173221343-173221365 GTTCAGCAGCACCATATAGTAGG - Intergenic
965884629 3:173429869-173429891 GTTCAGCAGCAACATGCTTTAGG - Intronic
966456162 3:180118195-180118217 ATGCAGCCACACCATGCTGTGGG - Intergenic
967688822 3:192449461-192449483 GTTCCACAGCACCCTGCTGTCGG + Intronic
968205341 3:196794734-196794756 GTTCAGCAACACCATGTTGTAGG + Intronic
968719086 4:2186380-2186402 GGTCAGTAGGACCATGTTGTAGG + Intronic
969473823 4:7409399-7409421 GTTCAGCAGCACCATGCTGTTGG - Intronic
970866156 4:20761164-20761186 GTTCACCAGCACCCTGCCTTTGG + Intronic
970866938 4:20770095-20770117 GTTCAGAAGAAGCAGGCTGTGGG - Intronic
971797346 4:31244696-31244718 ATTCAGCAGCACCACACTGTAGG + Intergenic
973950425 4:56007449-56007471 GTTCAGTAACAACATGCTGTAGG - Intronic
974964063 4:68738235-68738257 GCTTAGCAACAGCATGCTGTAGG - Intergenic
976833890 4:89348173-89348195 GTTCAGCAGTATCATGCTGTAGG - Intergenic
978888217 4:113791234-113791256 GTTCAGCAGCCCTATGCTGTAGG + Intergenic
979380796 4:120004189-120004211 GTTCAGCAGCACCACATTATAGG + Intergenic
980066209 4:128191628-128191650 GTTCAGCAGGACCACACTGTAGG - Intronic
980630207 4:135421578-135421600 GTTCTGCAGCAGAATTCTGTGGG + Intergenic
980659484 4:135839132-135839154 GTCATGCAGCCCCATGCTGTTGG + Intergenic
980868045 4:138576758-138576780 ATTCAGCAGCACCATGCTGTAGG + Intergenic
981159554 4:141481723-141481745 GTTCAGCAGCAGTATGCTGTAGG - Intergenic
981900692 4:149858378-149858400 ATTCAGCAGCACCATGCTGTAGG + Intergenic
982387943 4:154832969-154832991 ATTCAGCCTCACCATGCTGGGGG - Intergenic
982577338 4:157130898-157130920 GATCAGCTTCACTATGCTGTTGG - Intronic
983655622 4:170080587-170080609 GTTCAGCAGCACCACACTGCAGG + Intronic
984521249 4:180803753-180803775 TTCCAGCAGCACAATGCTGTTGG - Intergenic
985351107 4:189062225-189062247 GCTCACCAGCACCACACTGTGGG + Intergenic
985435049 4:189920645-189920667 GTTTATGGGCACCATGCTGTGGG + Intergenic
986341963 5:6796883-6796905 GCTCAACAGAACCATGCTCTTGG - Intergenic
986553942 5:8991235-8991257 TGTCAGCATCACCATGCTGCAGG - Intergenic
986719151 5:10547713-10547735 GGTCAGCAGCAGCATGGTGGGGG - Intergenic
986721627 5:10564460-10564482 GGCCAGCAGCACCATGCCGGCGG - Exonic
987260176 5:16195270-16195292 GATCAGCAGCATCAGTCTGTGGG + Intergenic
988412975 5:30910922-30910944 ATTCAGCAGGAACAAGCTGTTGG - Intergenic
989743311 5:44797563-44797585 GACCAGCAGCACAATGATGTTGG - Intergenic
991011596 5:61888409-61888431 GTTCAGCAGCACCACACTTTAGG + Intergenic
992654976 5:78900202-78900224 ATTCAGCAGCACCACACTGTAGG - Intronic
993241020 5:85385463-85385485 ATTTAGCAGCAGCATGCTGTAGG - Intergenic
993414202 5:87605843-87605865 ATTCAGCAGTACCAACCTGTAGG - Intergenic
993978957 5:94518491-94518513 GTTCTCAAGCACCATGCTATTGG - Intronic
994317561 5:98349724-98349746 GCTTAGCAGTACCATGCTGTAGG + Intergenic
994597170 5:101854205-101854227 GTTCAGCATCAGCACACTGTAGG + Intergenic
995278792 5:110308861-110308883 GTTTAGCAGCACCATACTGTAGG + Intronic
995553124 5:113300016-113300038 GTGCACCAACACCATGCTGTGGG + Intronic
995827534 5:116317395-116317417 GTTCAACAGCAACATGCTGTAGG - Intronic
996113454 5:119592340-119592362 GTTCTGCAGCACCATGCTGTAGG + Intronic
997258473 5:132447234-132447256 GCTCAGCAGCCCCAAGCTATGGG + Intronic
997420444 5:133762883-133762905 GTCCAGCAGCTTCATGCTTTGGG - Intergenic
997523031 5:134535407-134535429 TTCCAGGAGGACCATGCTGTCGG - Intronic
998148351 5:139743232-139743254 GCTCACCAGCACCTTGCTGGAGG + Intergenic
998580700 5:143372416-143372438 GTTCAGCATCTCCATGCTGTAGG - Intronic
999038974 5:148385593-148385615 TTTCAGCACCATCATCCTGTTGG + Intronic
999412402 5:151363277-151363299 GTTCAGCAGCACCACACTGTAGG - Intergenic
999660379 5:153856429-153856451 GTTCAGCAGCACCATGACACAGG - Intergenic
1000457014 5:161462232-161462254 GTTCTGCAGCACTCTGCTTTAGG + Intronic
1000806111 5:165794824-165794846 GTTCATCAGAACCATGCTGTGGG - Intergenic
1001734046 5:173984263-173984285 CTCCAGCAGCACCACGCTATGGG + Intronic
1003079623 6:3010744-3010766 GTTCAGCAGCACCACACTGTAGG + Intronic
1003155357 6:3589227-3589249 GTTCTGCAGCAGTATGCTTTGGG + Intergenic
1003642265 6:7886087-7886109 GTTGAGCAGGGCCATGCTTTGGG + Intronic
1004009253 6:11666208-11666230 ATTCAGCAGTACCAAGATGTTGG + Intergenic
1006275330 6:33000783-33000805 CTTCAGCAGCAACAGGCTGCAGG - Intergenic
1007040805 6:38720357-38720379 GTTTGGCAGTACCATGCTGTGGG + Intronic
1007585726 6:42988071-42988093 GTAGAGCAGCTCCATGCAGTAGG - Intronic
1007825256 6:44595235-44595257 GGTCAGCAGGACAATGGTGTAGG - Intergenic
1009693538 6:67067104-67067126 GTCTAGCAGCACCAAGCTATAGG - Intergenic
1010527563 6:76922536-76922558 GTTCAGCAGCTACTTGCTATAGG + Intergenic
1011508252 6:88071888-88071910 ACTCAGCAGCACTATGCTATAGG - Intergenic
1011790524 6:90893751-90893773 ATTCAAAAGCACCATGCTCTAGG + Intergenic
1014130789 6:117829862-117829884 CTTCAGCAGCACCACACAGTAGG + Intergenic
1014186973 6:118445785-118445807 ATTCAGCAGCCCTGTGCTGTAGG - Intergenic
1014308745 6:119772236-119772258 GTTCAGCAGCAATGTGCTTTGGG + Intergenic
1015216856 6:130760076-130760098 ATTCAGCAGCACCATGCTATAGG + Intergenic
1015736177 6:136402457-136402479 GTGCAGGAGCACCGTGTTGTGGG - Intronic
1016263771 6:142207445-142207467 GTTCAGCAGTACCATGCTGTAGG + Intronic
1016281874 6:142427599-142427621 TTTCAGCAGCACCATACTTCTGG + Intronic
1016554136 6:145316192-145316214 ATCCAGCACCTCCATGCTGTGGG - Intergenic
1016615356 6:146041622-146041644 GTTCAGCAGCACCACATTGTAGG - Intronic
1017186425 6:151605412-151605434 GTTCAGCAGGACCACACTGTAGG - Intronic
1017934132 6:158989534-158989556 GTTCAGCAGCACCACATTGTAGG - Intronic
1018839057 6:167506048-167506070 GTTCAGCAGCTGCCTGATGTGGG - Intergenic
1019089949 6:169520158-169520180 GCTCAGCATCACCACACTGTAGG + Intronic
1019131338 6:169879117-169879139 GTTCAGCAGCACGAGGCTATAGG - Intergenic
1019217322 6:170452297-170452319 CTTCAGCAGCACCCTCCTGGTGG - Intergenic
1019409758 7:901346-901368 GGTCACCAGCTCCAGGCTGTAGG - Intronic
1020116668 7:5480066-5480088 TTTCAGCAGCTCCTTGCTCTGGG - Intronic
1021030647 7:15729690-15729712 GTCCAGCACCACCCTGCTCTGGG + Intergenic
1021771830 7:24010811-24010833 GTTCAGCAGCACCACACTGTAGG - Intergenic
1022443501 7:30452082-30452104 GTTCCGCTGCACCAGGCTGCTGG + Exonic
1023846308 7:44122705-44122727 GTTCAGAGGCCCCTTGCTGTGGG - Intronic
1025040637 7:55641525-55641547 GTTCAGTAACACCATGCTGTAGG - Intergenic
1028560362 7:92168460-92168482 ATTCAGCAGCACCATGCTGTAGG + Intronic
1032867092 7:135936732-135936754 AATCAGCAGAATCATGCTGTAGG - Intronic
1035435364 7:158855666-158855688 GGTCAGAAGCAAGATGCTGTGGG + Intergenic
1035986516 8:4438482-4438504 GTTCCACAGCACCTGGCTGTAGG + Intronic
1037282772 8:17261814-17261836 ATTCAGCAGCTCCATGTTGTAGG - Intronic
1037758253 8:21725314-21725336 GGTCAGCAACAGCATGCTGAAGG + Intronic
1038347231 8:26743532-26743554 GTTTAGCAGCACCAGGTGGTTGG - Intergenic
1038751770 8:30302726-30302748 GTTCAGCAGCAGCATGGAGGAGG - Intergenic
1040774350 8:51021295-51021317 GTTCAGCATCACCATGCTATAGG + Intergenic
1041996126 8:64060515-64060537 GTTCAGGAGCACCGTTCTGTAGG + Intergenic
1042002341 8:64138699-64138721 ATTCAGCAGCACTGTACTGTAGG + Intergenic
1043033125 8:75164249-75164271 GTTCGGCAGCACCATGCTGAAGG - Intergenic
1043063799 8:75540637-75540659 GTTTAGCCGCACAAAGCTGTTGG + Intronic
1043932672 8:86108537-86108559 GTTCAGCAGCAGCAGAGTGTGGG + Intronic
1044407584 8:91846564-91846586 ATTCAGCAGTATCATGCTATAGG + Intergenic
1047697886 8:127420948-127420970 GTTCATCAGCACAAAGCTGGAGG + Intergenic
1048080114 8:131117764-131117786 GTTGAGCTGCACCATGCTATAGG - Intergenic
1049953590 9:670597-670619 GTTCGGCAGCACTATGCTGTAGG - Intronic
1050268752 9:3919074-3919096 GGTCAGCAGTACCATCCAGTTGG - Intronic
1050841821 9:10158979-10159001 GTTCAGCAGCACCATGTTGTAGG + Intronic
1052689544 9:31800037-31800059 GTTCAGCAGCACCATGCTATAGG + Intergenic
1052734671 9:32328812-32328834 GTTCAGCAGCACCGTGCTGTAGG + Intergenic
1053460298 9:38263602-38263624 GTTCATTTGCACTATGCTGTAGG + Intergenic
1055557331 9:77488527-77488549 GTTCAGCAGCATCACTCTGTAGG + Intronic
1057296303 9:93845023-93845045 GTTCACCAGCACCATGCTGTAGG - Intergenic
1060059585 9:120447231-120447253 GCTCAGCTGCATCATTCTGTGGG + Intronic
1060166955 9:121425315-121425337 GTTCAGCAGCACCACGCTGTGGG + Intergenic
1060918641 9:127405550-127405572 GTTCAGCAGCCTCATGGTGAGGG + Exonic
1061323662 9:129849011-129849033 GTTCAGCAGGCCCAGGCTGCAGG - Intronic
1203661179 Un_KI270753v1:44206-44228 ATTCCTCAGCACCATGCAGTTGG + Intergenic
1186994719 X:15107692-15107714 GGTCAGCAGCATCATACTGTAGG - Intergenic
1187714226 X:22086212-22086234 GTTCAGCAGCATTATGCTATAGG - Intronic
1187819837 X:23275648-23275670 GTTCAGCAGCATCAGCATGTTGG - Intergenic
1187941406 X:24386331-24386353 GTTCAGCAGCACCGTGTTGTAGG - Intergenic
1188382018 X:29506675-29506697 ATTCAGCAGTACTATACTGTAGG - Intronic
1188479026 X:30618444-30618466 GCTCAGCAGCACCATGCTATAGG + Intergenic
1188553361 X:31384596-31384618 CTTCAACAGCAGCATACTGTTGG - Intronic
1188901218 X:35734562-35734584 GCTGAGCAGCATCATTCTGTGGG - Intergenic
1188903135 X:35759739-35759761 GTTCAGTAGCACCACACTGTAGG - Intergenic
1189798917 X:44674065-44674087 TTTCAGCAGGGCCATGCTGAAGG + Intergenic
1190508151 X:51149158-51149180 GTTTAGCAGCACCACACAGTAGG - Intergenic
1191701507 X:64047556-64047578 GCTAAGCAGCATCATTCTGTAGG + Intergenic
1192521931 X:71809823-71809845 GTTCAGCAGCGCCACACTGTAGG - Intergenic
1192760769 X:74094172-74094194 TTTCAGCAGCACCATGCTGGAGG + Intergenic
1193178247 X:78420874-78420896 GTTCAGCACCACCATGTTGTAGG + Intergenic
1194530037 X:95035917-95035939 GTTCATCAGCACCATGCTGTAGG - Intergenic
1194613656 X:96074847-96074869 ATTCAGCAGCATCATGTTGTAGG + Intergenic
1195073568 X:101304636-101304658 GTTCAGCAGCATCATGCTGTAGG - Intergenic
1196067988 X:111487082-111487104 TTTCAGCCACACCATGCTATTGG + Intergenic
1196882779 X:120213718-120213740 GTTTAGCAGCACCACACTGTAGG + Intergenic
1196980928 X:121212942-121212964 GGTCAGCAGCACCATGCTACAGG - Intergenic
1196987106 X:121286368-121286390 GTTCGGCAGCACCACACGGTAGG - Intergenic
1197260612 X:124313209-124313231 GTTCAGCAGCACCACACTGCAGG + Intronic
1199095662 X:143735691-143735713 TTCCAGCAGCATGATGCTGTTGG - Intergenic
1199194821 X:145016010-145016032 ATTCAGCAGCACCATGCTATAGG + Intergenic
1199245045 X:145593953-145593975 GTTCAGCAGCAGCATGCTATAGG + Intergenic