ID: 1095781648

View in Genome Browser
Species Human (GRCh38)
Location 12:46066921-46066943
Sequence AGGGTTCAAGAGTGAAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095781648_1095781655 27 Left 1095781648 12:46066921-46066943 CCTCTCCTTCACTCTTGAACCCT No data
Right 1095781655 12:46066971-46066993 GCCACTAAAGCTGCCCTTATTGG No data
1095781648_1095781658 29 Left 1095781648 12:46066921-46066943 CCTCTCCTTCACTCTTGAACCCT No data
Right 1095781658 12:46066973-46066995 CACTAAAGCTGCCCTTATTGGGG No data
1095781648_1095781657 28 Left 1095781648 12:46066921-46066943 CCTCTCCTTCACTCTTGAACCCT No data
Right 1095781657 12:46066972-46066994 CCACTAAAGCTGCCCTTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095781648 Original CRISPR AGGGTTCAAGAGTGAAGGAG AGG (reversed) Intergenic
No off target data available for this crispr