ID: 1095781650

View in Genome Browser
Species Human (GRCh38)
Location 12:46066940-46066962
Sequence GGTGAAAGGCTGATTAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095781650_1095781657 9 Left 1095781650 12:46066940-46066962 CCCTCTCTAATCAGCCTTTCACC No data
Right 1095781657 12:46066972-46066994 CCACTAAAGCTGCCCTTATTGGG No data
1095781650_1095781661 28 Left 1095781650 12:46066940-46066962 CCCTCTCTAATCAGCCTTTCACC No data
Right 1095781661 12:46066991-46067013 TGGGGTCATAAAAAGCCTTATGG No data
1095781650_1095781658 10 Left 1095781650 12:46066940-46066962 CCCTCTCTAATCAGCCTTTCACC No data
Right 1095781658 12:46066973-46066995 CACTAAAGCTGCCCTTATTGGGG No data
1095781650_1095781655 8 Left 1095781650 12:46066940-46066962 CCCTCTCTAATCAGCCTTTCACC No data
Right 1095781655 12:46066971-46066993 GCCACTAAAGCTGCCCTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095781650 Original CRISPR GGTGAAAGGCTGATTAGAGA GGG (reversed) Intergenic
No off target data available for this crispr