ID: 1095781657

View in Genome Browser
Species Human (GRCh38)
Location 12:46066972-46066994
Sequence CCACTAAAGCTGCCCTTATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095781650_1095781657 9 Left 1095781650 12:46066940-46066962 CCCTCTCTAATCAGCCTTTCACC No data
Right 1095781657 12:46066972-46066994 CCACTAAAGCTGCCCTTATTGGG No data
1095781651_1095781657 8 Left 1095781651 12:46066941-46066963 CCTCTCTAATCAGCCTTTCACCT No data
Right 1095781657 12:46066972-46066994 CCACTAAAGCTGCCCTTATTGGG No data
1095781648_1095781657 28 Left 1095781648 12:46066921-46066943 CCTCTCCTTCACTCTTGAACCCT No data
Right 1095781657 12:46066972-46066994 CCACTAAAGCTGCCCTTATTGGG No data
1095781652_1095781657 -5 Left 1095781652 12:46066954-46066976 CCTTTCACCTTCACCATGCCACT No data
Right 1095781657 12:46066972-46066994 CCACTAAAGCTGCCCTTATTGGG No data
1095781649_1095781657 23 Left 1095781649 12:46066926-46066948 CCTTCACTCTTGAACCCTCTCTA No data
Right 1095781657 12:46066972-46066994 CCACTAAAGCTGCCCTTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095781657 Original CRISPR CCACTAAAGCTGCCCTTATT GGG Intergenic
No off target data available for this crispr