ID: 1095781662

View in Genome Browser
Species Human (GRCh38)
Location 12:46066994-46067016
Sequence GGTCATAAAAAGCCTTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095781653_1095781662 10 Left 1095781653 12:46066961-46066983 CCTTCACCATGCCACTAAAGCTG No data
Right 1095781662 12:46066994-46067016 GGTCATAAAAAGCCTTATGGAGG No data
1095781656_1095781662 -1 Left 1095781656 12:46066972-46066994 CCACTAAAGCTGCCCTTATTGGG No data
Right 1095781662 12:46066994-46067016 GGTCATAAAAAGCCTTATGGAGG No data
1095781652_1095781662 17 Left 1095781652 12:46066954-46066976 CCTTTCACCTTCACCATGCCACT No data
Right 1095781662 12:46066994-46067016 GGTCATAAAAAGCCTTATGGAGG No data
1095781654_1095781662 4 Left 1095781654 12:46066967-46066989 CCATGCCACTAAAGCTGCCCTTA No data
Right 1095781662 12:46066994-46067016 GGTCATAAAAAGCCTTATGGAGG No data
1095781651_1095781662 30 Left 1095781651 12:46066941-46066963 CCTCTCTAATCAGCCTTTCACCT No data
Right 1095781662 12:46066994-46067016 GGTCATAAAAAGCCTTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095781662 Original CRISPR GGTCATAAAAAGCCTTATGG AGG Intergenic
No off target data available for this crispr