ID: 1095784036

View in Genome Browser
Species Human (GRCh38)
Location 12:46090623-46090645
Sequence GCAATGCCACAGCTGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095784032_1095784036 -5 Left 1095784032 12:46090605-46090627 CCACCTGATTTGGACAGGGCAAT No data
Right 1095784036 12:46090623-46090645 GCAATGCCACAGCTGGAGCAGGG No data
1095784025_1095784036 15 Left 1095784025 12:46090585-46090607 CCCCTCTAAGATCCAACAGGCCA No data
Right 1095784036 12:46090623-46090645 GCAATGCCACAGCTGGAGCAGGG No data
1095784029_1095784036 3 Left 1095784029 12:46090597-46090619 CCAACAGGCCACCTGATTTGGAC No data
Right 1095784036 12:46090623-46090645 GCAATGCCACAGCTGGAGCAGGG No data
1095784024_1095784036 16 Left 1095784024 12:46090584-46090606 CCCCCTCTAAGATCCAACAGGCC No data
Right 1095784036 12:46090623-46090645 GCAATGCCACAGCTGGAGCAGGG No data
1095784026_1095784036 14 Left 1095784026 12:46090586-46090608 CCCTCTAAGATCCAACAGGCCAC No data
Right 1095784036 12:46090623-46090645 GCAATGCCACAGCTGGAGCAGGG No data
1095784033_1095784036 -8 Left 1095784033 12:46090608-46090630 CCTGATTTGGACAGGGCAATGCC No data
Right 1095784036 12:46090623-46090645 GCAATGCCACAGCTGGAGCAGGG No data
1095784027_1095784036 13 Left 1095784027 12:46090587-46090609 CCTCTAAGATCCAACAGGCCACC No data
Right 1095784036 12:46090623-46090645 GCAATGCCACAGCTGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095784036 Original CRISPR GCAATGCCACAGCTGGAGCA GGG Intergenic
No off target data available for this crispr