ID: 1095788027

View in Genome Browser
Species Human (GRCh38)
Location 12:46132024-46132046
Sequence CAGGAAAGCATGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095788021_1095788027 19 Left 1095788021 12:46131982-46132004 CCAGGATAAAGTCACTTTTGTCA No data
Right 1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG No data
1095788023_1095788027 -7 Left 1095788023 12:46132008-46132030 CCAAACAAGTTCAAGTCAGGAAA No data
Right 1095788027 12:46132024-46132046 CAGGAAAGCATGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095788027 Original CRISPR CAGGAAAGCATGAAGGAGGA GGG Intergenic
No off target data available for this crispr