ID: 1095788079

View in Genome Browser
Species Human (GRCh38)
Location 12:46132679-46132701
Sequence TTGCAGAGCCAGGATGTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095788076_1095788079 7 Left 1095788076 12:46132649-46132671 CCATTTGTCCAGGAGCACATAGT No data
Right 1095788079 12:46132679-46132701 TTGCAGAGCCAGGATGTGATTGG No data
1095788077_1095788079 -1 Left 1095788077 12:46132657-46132679 CCAGGAGCACATAGTTTGCAAGT No data
Right 1095788079 12:46132679-46132701 TTGCAGAGCCAGGATGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095788079 Original CRISPR TTGCAGAGCCAGGATGTGAT TGG Intergenic
No off target data available for this crispr