ID: 1095794633

View in Genome Browser
Species Human (GRCh38)
Location 12:46204881-46204903
Sequence GGCTCTTTTCTGCTGGATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095794633_1095794639 19 Left 1095794633 12:46204881-46204903 CCAGAATCCAGCAGAAAAGAGCC 0: 1
1: 0
2: 3
3: 20
4: 191
Right 1095794639 12:46204923-46204945 TCTGTGTTGGTGGACCCTGATGG 0: 1
1: 0
2: 3
3: 9
4: 157
1095794633_1095794641 30 Left 1095794633 12:46204881-46204903 CCAGAATCCAGCAGAAAAGAGCC 0: 1
1: 0
2: 3
3: 20
4: 191
Right 1095794641 12:46204934-46204956 GGACCCTGATGGAGTCCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1095794633_1095794640 29 Left 1095794633 12:46204881-46204903 CCAGAATCCAGCAGAAAAGAGCC 0: 1
1: 0
2: 3
3: 20
4: 191
Right 1095794640 12:46204933-46204955 TGGACCCTGATGGAGTCCTATGG 0: 1
1: 0
2: 0
3: 7
4: 87
1095794633_1095794638 9 Left 1095794633 12:46204881-46204903 CCAGAATCCAGCAGAAAAGAGCC 0: 1
1: 0
2: 3
3: 20
4: 191
Right 1095794638 12:46204913-46204935 TTGCTGTAAGTCTGTGTTGGTGG 0: 1
1: 0
2: 0
3: 13
4: 222
1095794633_1095794637 6 Left 1095794633 12:46204881-46204903 CCAGAATCCAGCAGAAAAGAGCC 0: 1
1: 0
2: 3
3: 20
4: 191
Right 1095794637 12:46204910-46204932 TTTTTGCTGTAAGTCTGTGTTGG 0: 1
1: 0
2: 1
3: 23
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095794633 Original CRISPR GGCTCTTTTCTGCTGGATTC TGG (reversed) Intronic