ID: 1095794641

View in Genome Browser
Species Human (GRCh38)
Location 12:46204934-46204956
Sequence GGACCCTGATGGAGTCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095794635_1095794641 9 Left 1095794635 12:46204902-46204924 CCTTCCAATTTTTGCTGTAAGTC 0: 1
1: 0
2: 2
3: 10
4: 175
Right 1095794641 12:46204934-46204956 GGACCCTGATGGAGTCCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1095794636_1095794641 5 Left 1095794636 12:46204906-46204928 CCAATTTTTGCTGTAAGTCTGTG 0: 1
1: 0
2: 0
3: 17
4: 244
Right 1095794641 12:46204934-46204956 GGACCCTGATGGAGTCCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1095794633_1095794641 30 Left 1095794633 12:46204881-46204903 CCAGAATCCAGCAGAAAAGAGCC 0: 1
1: 0
2: 3
3: 20
4: 191
Right 1095794641 12:46204934-46204956 GGACCCTGATGGAGTCCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1095794634_1095794641 23 Left 1095794634 12:46204888-46204910 CCAGCAGAAAAGAGCCTTCCAAT 0: 1
1: 0
2: 0
3: 9
4: 210
Right 1095794641 12:46204934-46204956 GGACCCTGATGGAGTCCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095794641 Original CRISPR GGACCCTGATGGAGTCCTAT GGG Intronic
900310271 1:2030077-2030099 GGAACCTGATGGGCTCCTACAGG + Exonic
904858417 1:33517255-33517277 GGGCCCTGCTGGAGACCTGTGGG + Intronic
905997286 1:42392254-42392276 GGACCCTGATGTAGGTCTGTTGG + Intronic
906311968 1:44760585-44760607 GGGCCCTGATGCACTCCTGTGGG - Exonic
911955686 1:104231841-104231863 GGACCCTGATGGAGATGTACAGG - Intergenic
1066011086 10:31193861-31193883 GGTCTCTGATAGAGTGCTATTGG - Intergenic
1068733607 10:60387288-60387310 AGATCCTGATGAAGGCCTATGGG - Intronic
1076179991 10:128399602-128399624 GGAACCTGAGGGAGCCCTGTGGG + Intergenic
1081708970 11:45204936-45204958 GCCCCCTGATGGAGGCCTAGGGG - Intronic
1084307896 11:68298703-68298725 GCTCCCTGGTGGAGTCCTAGAGG - Intergenic
1085445128 11:76596401-76596423 GGACCATAATGCAGTCCTAATGG + Intergenic
1087895073 11:103577774-103577796 GGACCCACCTGGAGTCCCATGGG + Intergenic
1089003099 11:115068504-115068526 GGACACTGATGGAGCCCTCCTGG + Intergenic
1093199203 12:16166885-16166907 AGAGCCTGATGGAGTCTTTTAGG - Intergenic
1095756688 12:45775425-45775447 GGATTCAGATGGAGTCTTATTGG - Intronic
1095794641 12:46204934-46204956 GGACCCTGATGGAGTCCTATGGG + Intronic
1096230618 12:49894944-49894966 AGACCCGGATGGAGTCCTCAGGG + Intronic
1100581499 12:95943740-95943762 GGACCCTGATGCGTTCCAATGGG - Intronic
1101227761 12:102707071-102707093 GTACCCTGATGGAGCCCCACAGG - Intergenic
1104787440 12:131458733-131458755 GGACCCTGAGGCCGTCCTACAGG + Intergenic
1104958270 12:132476357-132476379 GGACCCTGATCCAGTCCCATGGG - Intergenic
1107217477 13:37938125-37938147 TGACACTGATGAGGTCCTATTGG + Intergenic
1110826223 13:79974781-79974803 GGAACCTGTTGGAGTCCTGATGG - Intergenic
1111725019 13:91996274-91996296 GAACCCTGTTGGAGTCCTAGTGG - Intronic
1115795958 14:36935905-36935927 GGAACCTTATGGAGTCCTGCAGG + Intronic
1117447743 14:55820876-55820898 GGACCCACCTGGAGTCCCATCGG - Intergenic
1117993461 14:61457463-61457485 GGAGCATGAGGGAGTCCTCTTGG - Intronic
1119598312 14:75956938-75956960 GGACCCTACTGCAGTCCTAAAGG + Intronic
1129717283 15:77859767-77859789 GGCCCCACATGGAGTCCTACAGG - Intergenic
1130461753 15:84164532-84164554 GGCCCCATATGGAGTCCTACAGG + Intergenic
1133053135 16:3129990-3130012 GGACACTCAAGCAGTCCTATAGG + Intronic
1139811013 16:69616911-69616933 GGACTCAGATGGAGTCCAAGAGG - Intronic
1142470087 17:158334-158356 GGAGCCTGGTAGAGTCCTAAGGG - Intronic
1142803065 17:2357031-2357053 AGATGCTGATGGAATCCTATGGG - Intronic
1144101032 17:11942527-11942549 GGACACAGATGGACCCCTATGGG + Intronic
1144779357 17:17800050-17800072 GGAACCTGCAGGAGTCCTGTCGG - Intronic
1145991327 17:29080900-29080922 TGCCCCCGATGGAGTCCTTTAGG + Intronic
1147918337 17:43901497-43901519 GTACCCTGATGGTGGCCTCTTGG - Intronic
1151283859 17:73095833-73095855 GAATCCAGATGGAGTTCTATGGG - Intergenic
1156297015 18:35801849-35801871 GGCCCCAAATGGAGTCCTACAGG + Intergenic
1158417075 18:57257879-57257901 GGAGCCAGATGCAGTCCTACAGG + Intergenic
1160063691 18:75554933-75554955 GGGCCCTGAAGGAATACTATAGG + Intergenic
1160443847 18:78912582-78912604 GAACCCTCATGGAGTCCCACGGG - Intergenic
1166406689 19:42526713-42526735 AGACCCTGACTGAGTCCTACTGG + Intronic
926323502 2:11765247-11765269 GGACCCTGATGGACCCTGATGGG + Intronic
935365467 2:102285076-102285098 GAAGCCTTATGGAGTCCTCTAGG - Intergenic
938938550 2:136148640-136148662 GGACACTGATGCAGTCATAGTGG - Intergenic
946432087 2:219631403-219631425 GGCCCCTGATGGACTCCCACAGG - Intronic
1169950575 20:11038962-11038984 GGGCCCTAATGAAGGCCTATAGG + Intergenic
1177354980 21:19996506-19996528 GGACCCACCTGGAGTCCCATTGG - Intergenic
1184688059 22:46105243-46105265 GGACCCTGTGGGAGCCCTGTGGG + Intronic
960853121 3:122076581-122076603 GGACCCTGGGGGAGCCCTGTGGG + Intronic
961183674 3:124896186-124896208 GGAAGCTGATGGAGGCCTCTTGG - Intronic
962088711 3:132220259-132220281 GGACACTCAGGCAGTCCTATGGG + Intronic
967214552 3:187199354-187199376 GGAACCTGCTGTAGTCCTAGGGG + Intronic
977908732 4:102506712-102506734 GAACCCTAATGCAGTCCTGTGGG + Intronic
980156641 4:129115564-129115586 AGACCCTAGTGGAGTCCTACTGG - Exonic
995400952 5:111741088-111741110 TATCCCTGATGGGGTCCTATAGG + Intronic
998428717 5:142051738-142051760 GGACACTCAAGCAGTCCTATGGG - Intergenic
998964580 5:147525391-147525413 GGACCCTTATTGACTCCAATAGG + Intergenic
1002603944 5:180370959-180370981 TGTCCCTGGTGGAGTCCGATGGG + Intergenic
1003800166 6:9655320-9655342 GGACCTTGATGAAGTCCTACAGG - Intronic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1008123810 6:47646804-47646826 GGACCCACCTGGAGTCCCATCGG + Intergenic
1018832113 6:167451168-167451190 GGACCCTGATGGGAACCTATGGG - Intergenic
1020097167 7:5375709-5375731 GGACACTGAAGGAGTCCAGTGGG - Intronic
1022161529 7:27715578-27715600 GGACCCTGATGAAGACAGATAGG - Intergenic
1035308678 7:157951513-157951535 AGACCGTGATGGAGCCCCATGGG - Intronic
1045507037 8:102786118-102786140 GGACCCTGATCCAGTCCACTGGG + Intergenic
1047668305 8:127116918-127116940 GGAACCTGCTGGAGTTCTAAAGG - Intergenic
1051431428 9:16984429-16984451 GGAGCCTGATGGACTCTTCTGGG + Intergenic
1062123226 9:134845493-134845515 GGACCCTGCTGGAGACCCACTGG - Intergenic
1199231585 X:145442675-145442697 TGACAGTGATGGAGTCCAATGGG + Intergenic
1201778938 Y:17696984-17697006 GGACCCCCATTGAGACCTATTGG - Intergenic
1201822618 Y:18209008-18209030 GGACCCCCATTGAGACCTATTGG + Intergenic
1202377515 Y:24250618-24250640 GGCCCCATATGGAGTCCTACAGG - Intergenic
1202493266 Y:25419504-25419526 GGCCCCATATGGAGTCCTACAGG + Intergenic