ID: 1095794641

View in Genome Browser
Species Human (GRCh38)
Location 12:46204934-46204956
Sequence GGACCCTGATGGAGTCCTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095794633_1095794641 30 Left 1095794633 12:46204881-46204903 CCAGAATCCAGCAGAAAAGAGCC 0: 1
1: 0
2: 3
3: 20
4: 191
Right 1095794641 12:46204934-46204956 GGACCCTGATGGAGTCCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1095794635_1095794641 9 Left 1095794635 12:46204902-46204924 CCTTCCAATTTTTGCTGTAAGTC 0: 1
1: 0
2: 2
3: 10
4: 175
Right 1095794641 12:46204934-46204956 GGACCCTGATGGAGTCCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1095794636_1095794641 5 Left 1095794636 12:46204906-46204928 CCAATTTTTGCTGTAAGTCTGTG 0: 1
1: 0
2: 0
3: 17
4: 244
Right 1095794641 12:46204934-46204956 GGACCCTGATGGAGTCCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 72
1095794634_1095794641 23 Left 1095794634 12:46204888-46204910 CCAGCAGAAAAGAGCCTTCCAAT 0: 1
1: 0
2: 0
3: 9
4: 210
Right 1095794641 12:46204934-46204956 GGACCCTGATGGAGTCCTATGGG 0: 1
1: 0
2: 0
3: 4
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095794641 Original CRISPR GGACCCTGATGGAGTCCTAT GGG Intronic