ID: 1095797665

View in Genome Browser
Species Human (GRCh38)
Location 12:46237967-46237989
Sequence CATTATAACCAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095797657_1095797665 30 Left 1095797657 12:46237914-46237936 CCTGGTAGCATTTAATAGAACTA 0: 1
1: 0
2: 0
3: 3
4: 101
Right 1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 10
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095797665 Original CRISPR CATTATAACCAGAGGGAGGA GGG Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
902118568 1:14142132-14142154 CCTTAAAACCAGATGGAGGTAGG + Intergenic
902990541 1:20184644-20184666 CATTAGAACTGGAGGGAGGGAGG + Intergenic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
904619488 1:31766696-31766718 CATTATTACCAGAGTGAGTCTGG - Intergenic
905025930 1:34849432-34849454 CATTAGAACAGGAGGGAGCAGGG + Intronic
905168302 1:36096425-36096447 AATTGGAACCAGAGGGTGGAAGG + Exonic
905324921 1:37145144-37145166 CATTTTACCCAGAGGAAGGAAGG + Intergenic
905478040 1:38242664-38242686 CATTATAGCCTGGGGGAGGTGGG - Intergenic
906315839 1:44786022-44786044 CTTTAAAATTAGAGGGAGGAGGG + Intronic
907431456 1:54414482-54414504 CATTACAGCCAGAGGAAGGAAGG - Intergenic
907814822 1:57908262-57908284 CATCATAGCCAAAGGCAGGAGGG - Intronic
908740387 1:67321456-67321478 CATTATAACCAGAGACATGTAGG + Intronic
908947427 1:69516524-69516546 CACAAGAACCAGAGGCAGGAGGG - Intergenic
909609767 1:77539810-77539832 CAGTAAAACAACAGGGAGGAGGG - Intronic
909837455 1:80274999-80275021 CATTATTACCAAAGGAAGTATGG - Intergenic
912702191 1:111886741-111886763 CATTTTAACCAAAAGGAGAAAGG + Intronic
912798366 1:112706302-112706324 CTTTAAAACCAGAGTGAGGGCGG + Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
915812081 1:158923765-158923787 CATAATAACAAGATTGAGGAAGG + Intergenic
915999330 1:160599722-160599744 CATTATAATCAGGAGGAGGTGGG + Intergenic
917475016 1:175362009-175362031 CATAATGACCAGAGGAAGGGAGG - Intronic
922063658 1:222115458-222115480 CATTAGAAAAGGAGGGAGGAAGG - Intergenic
922789255 1:228301418-228301440 CATTATAACCAGAGGGTAGAGGG - Intronic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
923896996 1:238282121-238282143 CATTCTAACCAGATTTAGGATGG + Intergenic
1063047896 10:2412291-2412313 CATTACAAACACAGGGAGTAAGG - Intergenic
1063183108 10:3624067-3624089 CACTATAAATAGAGGAAGGAGGG + Intergenic
1066369599 10:34809336-34809358 CATTTCACCCGGAGGGAGGAAGG + Intronic
1066618551 10:37321017-37321039 CATGGTAACAAAAGGGAGGATGG - Intronic
1067138445 10:43632992-43633014 CACTATAAAAAGAGTGAGGAAGG - Intergenic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1067843964 10:49703716-49703738 TGTTATATCCAGCGGGAGGAAGG - Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1072180755 10:92977245-92977267 CATTCCAAGCAGAGAGAGGATGG - Intronic
1073245228 10:102085738-102085760 CATTATCCTCAGAAGGAGGAGGG + Intergenic
1073579702 10:104653961-104653983 AATGATTACCAGAGGCAGGAAGG - Intronic
1074760999 10:116667535-116667557 CATTAGGACCAGAGTGAGGTTGG + Intronic
1077913397 11:6594195-6594217 CATTCTAAACTGAGTGAGGAGGG + Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1080185779 11:29483706-29483728 CATAATAACAAAAGGGAAGAAGG - Intergenic
1080711556 11:34752684-34752706 CATTATACTCATAGGGAAGAGGG + Intergenic
1080718072 11:34823419-34823441 CATGATACCCAGAGTGAGGGAGG + Intergenic
1080934346 11:36846553-36846575 TATTACAACCTGAGGAAGGAAGG + Intergenic
1081827914 11:46076005-46076027 CTTTCTAACCAGAGGGAGAGTGG + Intronic
1082890051 11:58129529-58129551 GATCAAAACCAGAGGGAGGTTGG - Intronic
1084260791 11:67977320-67977342 CCTTATATCCAGAGGGAGAGAGG + Intergenic
1084738712 11:71123501-71123523 CATCATAAGGAGAGGGAGGGAGG + Intronic
1085374981 11:76052280-76052302 CATCATAACCGGGGGGATGAAGG - Intronic
1087306365 11:96493780-96493802 CATTAAAACCAGTGGCAGTATGG + Intronic
1089606542 11:119644730-119644752 CATTGTAGGCAGAGTGAGGAGGG + Intronic
1089702884 11:120255863-120255885 CAAGGTCACCAGAGGGAGGAAGG - Intronic
1091227519 11:133966414-133966436 CATTCCAACAAGAGGGAGGCTGG + Intergenic
1094083435 12:26563082-26563104 TATGCTAATCAGAGGGAGGAGGG - Intronic
1095498557 12:42811672-42811694 CCTTACAGCCTGAGGGAGGAGGG + Intergenic
1095752321 12:45727284-45727306 AATTGTAACTAGAGGGAGAACGG - Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1097606275 12:61758476-61758498 CATTTTAACAAGAGGAAGGTGGG + Intronic
1097784909 12:63748279-63748301 CGTAATAGCCAGACGGAGGAGGG + Intergenic
1099595020 12:84650743-84650765 CAACATAAGCAGAGGGAGCAGGG - Intergenic
1101489665 12:105199272-105199294 CATTAAAGTCAGAGGGAGGTGGG - Intronic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1101789031 12:107911524-107911546 CATTAGTCCCAGAGGGTGGAGGG + Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1104630300 12:130395088-130395110 CCTTAGAAGCAGCGGGAGGAAGG + Intergenic
1106644222 13:31615587-31615609 CTTAATAACCAGAGGGGAGATGG + Intergenic
1107186708 13:37530915-37530937 CTTTATAAACTTAGGGAGGAAGG + Intergenic
1110497347 13:76184281-76184303 AATTATTACCAAAGAGAGGAAGG + Intergenic
1111663254 13:91236962-91236984 CATTTTAACCAGAGAGGGAAGGG + Intergenic
1115577878 14:34728693-34728715 AATTATTACCAGAGGTAGGGGGG - Intergenic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116799220 14:49425802-49425824 CATTATAGAAAGATGGAGGAAGG - Intergenic
1117049594 14:51847009-51847031 CATGGTAACCAGAGGGGGGGAGG + Intronic
1119914787 14:78387778-78387800 CATTATCACCATAGGAAAGAAGG - Intronic
1120838221 14:89060106-89060128 CATTAGAACCAGGGGCAGGCAGG - Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1125933061 15:43613644-43613666 TATTAAAACCAGGGAGAGGATGG - Intronic
1125946159 15:43713106-43713128 TATTAAAACCAGGGAGAGGATGG - Intergenic
1127685797 15:61342389-61342411 CATTTTAACCAGAGCAAAGAAGG - Intergenic
1127869902 15:63063107-63063129 CTTTATATCCTGAAGGAGGAGGG + Intronic
1128593741 15:68926266-68926288 CATTCTAACTGGAGGGATGATGG + Intronic
1128686681 15:69691525-69691547 CATGTGAACCAGAGAGAGGATGG + Intergenic
1130579132 15:85118928-85118950 AATAAGAACCAGAGGGAGCACGG - Intronic
1132065492 15:98727653-98727675 CATTATACCCAGGGGCTGGAGGG + Intronic
1132980182 16:2734623-2734645 CATTAGAACCACAGTGAGGCCGG + Intergenic
1136654788 16:31703353-31703375 CATCATACCCACAGGGAGAAGGG - Intergenic
1137884396 16:52086926-52086948 CACTAGAAGCAGAAGGAGGAGGG + Intergenic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1139119336 16:63996901-63996923 CATTATTATCACAGGGAGGTAGG + Intergenic
1140049595 16:71468354-71468376 AAATATAGCCAGAGGGAGGCTGG - Intronic
1140593268 16:76378121-76378143 GATTCTAAAAAGAGGGAGGATGG + Intronic
1141265122 16:82489634-82489656 CATTACAACTAGAGGCAGGTTGG - Intergenic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1145105036 17:20108024-20108046 CCTTTTAACAAGAGGGATGACGG - Intronic
1147129105 17:38395616-38395638 TATTGCAGCCAGAGGGAGGAAGG + Intronic
1150135268 17:62691962-62691984 CACAGTAACCAGAGGTAGGATGG + Intronic
1150178202 17:63084981-63085003 CATTATAACCAGTTGATGGATGG + Intronic
1151088954 17:71413293-71413315 GATTATTTCCAGAGGAAGGAGGG + Intergenic
1152436163 17:80277805-80277827 CATTCTAACCATGGTGAGGAGGG + Intronic
1154174575 18:12076871-12076893 AATTATAACCAGATGGTAGAAGG + Intergenic
1154999759 18:21674844-21674866 CCTGATAGCCAGAGGGAGGAGGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156902430 18:42316056-42316078 CACTAAAACCAGAGGGCAGAAGG - Intergenic
1157216291 18:45786341-45786363 CATTATAACGAAAGGGGGGTTGG + Intergenic
1157404056 18:47408869-47408891 ATTCATAACAAGAGGGAGGAGGG + Intergenic
1157824736 18:50802542-50802564 CAGGTAAACCAGAGGGAGGAGGG + Intronic
1158888901 18:61855114-61855136 AATTATAACCAGTGGGAAGAAGG + Intronic
1159108866 18:64032985-64033007 CATCAGATCCAGAGGGAGCAAGG - Intergenic
1159560553 18:69988377-69988399 CATTATAATCAGAGTCATGAAGG + Intergenic
1159768881 18:72524370-72524392 CATTATAACCAGAAATAGCATGG + Intergenic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1163532582 19:17859301-17859323 CATAAGAACCTGAGGGAGCAGGG - Intergenic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1164520190 19:28973187-28973209 CAGTGACACCAGAGGGAGGAGGG + Intergenic
1164889759 19:31813117-31813139 GATTATAAACAGAGGCAGGAAGG + Intergenic
1166937502 19:46343288-46343310 CATCACCTCCAGAGGGAGGAGGG - Exonic
1168394644 19:56037834-56037856 CATGAAAACCTGAGGGAGGGAGG + Intronic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
927325283 2:21798367-21798389 AATAATATCCAGTGGGAGGATGG + Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
930640295 2:53847553-53847575 CATTATTTCAAGAGGGAGAATGG + Intergenic
931508147 2:62955697-62955719 CATTGTAATCATGGGGAGGAGGG + Intronic
932018060 2:68053276-68053298 CTGTATAACCAGTGAGAGGAAGG - Intronic
932353780 2:71051845-71051867 CCTTATATCCAGAGGGAGAGGGG - Intergenic
936025360 2:109027528-109027550 TATCATAAACAGAGGGTGGATGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
940285721 2:152031525-152031547 CAGCACAACCTGAGGGAGGAAGG + Intronic
940342014 2:152591303-152591325 AAATATTACCAGAGGGAGGCCGG - Intronic
940556516 2:155234982-155235004 CATTACAAAGAGAGGTAGGAGGG - Intergenic
940794254 2:158060445-158060467 CATTCAAAGCAGAGGCAGGATGG - Intronic
941418435 2:165251626-165251648 AATTAGAATCAGAGGGAGTAGGG - Intronic
941753016 2:169153071-169153093 TATTATAACAACAGTGAGGAGGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
945338707 2:208623886-208623908 TTTTTTAATCAGAGGGAGGAAGG + Intronic
946067258 2:216998639-216998661 CATTATAACCAGATGAAAGGGGG - Intergenic
946391543 2:219419408-219419430 CAGTGTAGCCAGAGGGAGAAGGG + Intronic
946560767 2:220910208-220910230 CATTTTAACCAGCTGGAGCAGGG + Intergenic
946588574 2:221218081-221218103 CATGATGACCACAGGGACGAAGG + Intergenic
948855061 2:240726312-240726334 CATTAAAAGCACATGGAGGATGG + Intronic
1168879721 20:1196143-1196165 CACTCTAACCAGAGGGGGCATGG - Intergenic
1170838834 20:19907487-19907509 ACTTATCACCAGAGCGAGGAAGG + Intronic
1173347545 20:42214784-42214806 CCATGTACCCAGAGGGAGGAGGG - Intronic
1175173768 20:57097422-57097444 CCATGTGACCAGAGGGAGGACGG - Intergenic
1176697824 21:10002044-10002066 GACTATTACAAGAGGGAGGAAGG - Intergenic
1179898407 21:44376335-44376357 CATTTTAGCCAGTGGGAGGGCGG + Intronic
1182134556 22:27889161-27889183 CCTGATAACCTGAGGGAGGAGGG + Intronic
1182282281 22:29224538-29224560 AATGAAAACCAGAGGGAGGCTGG - Intronic
1182939660 22:34263421-34263443 CATTCAAACCAGAGGGACAAAGG + Intergenic
1185292668 22:50035026-50035048 CATCATAACCACAGGGAATAAGG + Intronic
949212235 3:1516802-1516824 AATTGTAACCAGAGTGAGGATGG + Intergenic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
952240457 3:31526984-31527006 CATTAGAAGCAGAGGAAGGCCGG - Intergenic
953352686 3:42227771-42227793 CATTCCAAGCAGAGGAAGGATGG + Intergenic
954259150 3:49426162-49426184 CAATATACCAAGAGGGAAGAGGG - Intronic
955872127 3:63450498-63450520 CATTTTAAACAGAGGAAGGCTGG + Intronic
958164059 3:89856452-89856474 CAAAATAATCCGAGGGAGGAAGG + Intergenic
959946345 3:112129578-112129600 CATTATAACAAGGGAGAGGTTGG - Intronic
960432225 3:117583080-117583102 CATTAAAATCAGAGTGGGGAAGG - Intergenic
960673814 3:120176111-120176133 CATCATGACCAGAGGCAGGGAGG - Intronic
961278353 3:125745008-125745030 CCTTATATCCAGAGGGAGAGAGG - Intergenic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
965087277 3:164114652-164114674 GATTATAAACAGTGGGAGGTAGG + Intergenic
967393408 3:188979742-188979764 ATTCATAATCAGAGGGAGGAGGG - Intronic
968348289 3:198030297-198030319 CATAATCACCACTGGGAGGATGG - Intronic
968929944 4:3573530-3573552 CATGAAAACCAGAGTGAGAAGGG + Intergenic
973312654 4:48726273-48726295 CATTATGCCCAGAAGGAGAAGGG - Intronic
980222761 4:129940929-129940951 CATTATAAAGAGAAGGAGAAGGG - Intergenic
980370371 4:131861917-131861939 GACTATTACAAGAGGGAGGAAGG - Intergenic
983560170 4:169093016-169093038 TAGTATCACCAGAGGCAGGAAGG - Intergenic
984166185 4:176305386-176305408 CATTATAGCCAGAGAGAACAAGG - Intergenic
988130765 5:27101871-27101893 CATTATAACTAGAGGTAGAGTGG + Intronic
988785315 5:34561389-34561411 TCTTAGATCCAGAGGGAGGAAGG - Intergenic
989664923 5:43842735-43842757 CATGATAACCAAAGGGAAGAGGG + Intergenic
990681070 5:58245000-58245022 CATTACAATCAGAGGAAGAAGGG + Intergenic
993822795 5:92641066-92641088 CATTAGAACCAGAGGTAAGCTGG + Intergenic
994007532 5:94856915-94856937 CCTTAAAAGCAGAGAGAGGAAGG + Intronic
995046424 5:107653613-107653635 TATTTTAACTAGAGGGAAGAGGG + Intronic
996236164 5:121132826-121132848 CATTAAAAAGAGAGGAAGGAGGG + Intergenic
996430568 5:123371602-123371624 AACTAGAACCACAGGGAGGATGG + Intronic
996988227 5:129594598-129594620 CATTATAATCAAATGGAAGAAGG - Intronic
997685554 5:135785698-135785720 CATAATATCCAGAGGGGAGAGGG + Intergenic
998058850 5:139103334-139103356 CCTTTTAAAAAGAGGGAGGAAGG - Intronic
998779351 5:145639340-145639362 CTTGAAAACCAGAGGGAGAAGGG + Intronic
999582286 5:153052303-153052325 AATTATTAACAGAAGGAGGAAGG + Intergenic
1000957523 5:167560455-167560477 GATTATAACCACAGGGAGAGTGG + Intronic
1005905644 6:30260063-30260085 TATTACAACCAGAGCGAGGCCGG + Intergenic
1006043198 6:31271598-31271620 TACTACAACCAGAGCGAGGACGG - Exonic
1006052089 6:31353013-31353035 CATTATAACCAGAGTAAGGAAGG - Intronic
1007070577 6:39035115-39035137 CATGGTAACCAGAAGGAGCATGG + Intergenic
1007723236 6:43898500-43898522 CATTCCAGCCAGAGGGAAGAGGG - Intergenic
1012911509 6:105123139-105123161 TATTACTACCTGAGGGAGGAAGG - Intronic
1015296216 6:131596424-131596446 CATTAGAACCAGAGAGAAAACGG + Intronic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016772141 6:147863443-147863465 CATCATAATGAGAGGCAGGAAGG - Intergenic
1017834491 6:158164915-158164937 CATTCTAGCAAGAGGGAGGAGGG - Intronic
1018201929 6:161403142-161403164 CACTAAATCGAGAGGGAGGAAGG - Intronic
1020077320 7:5266867-5266889 CATTGAAACCAAAGGGAGAAGGG + Intergenic
1022203984 7:28145528-28145550 AATAATAACAAGAGGGAGAAGGG + Intronic
1022456508 7:30563036-30563058 CATTCTAACCAGAGTCAAGAGGG - Intergenic
1023362769 7:39432751-39432773 TCTCAGAACCAGAGGGAGGATGG - Intronic
1026079571 7:67205623-67205645 CATTATAACCAGGTGAAGGTGGG + Intronic
1026586644 7:71661091-71661113 CATTGTAACCACAGTGAGCAGGG - Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1030489927 7:110219486-110219508 CATTATAACCAGAGGAACTACGG - Intergenic
1031075493 7:117208474-117208496 TATCAGACCCAGAGGGAGGAAGG + Intronic
1031147240 7:118010365-118010387 CATTATAACCATAAGAAGGTAGG + Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033772564 7:144568617-144568639 AATTATAATCAGAGGGCTGATGG - Intronic
1033928047 7:146488320-146488342 CATTAAAGCAAGAGGAAGGAAGG - Intronic
1034486410 7:151366980-151367002 CACTATATCCAGCTGGAGGACGG - Exonic
1035945111 8:3953975-3953997 CATCACCACCAGAGGAAGGAAGG - Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1039795067 8:40905923-40905945 CATCATAAAAAGGGGGAGGAGGG + Intergenic
1039901610 8:41756751-41756773 CATTTTAAACAGGGGCAGGATGG + Intronic
1041441826 8:57905181-57905203 CATCATAACCAAGGGGAAGAAGG + Intergenic
1043484612 8:80686976-80686998 ATTTATAACCAGAGGATGGATGG + Intronic
1044375086 8:91460741-91460763 GATTAAACCCAGAGAGAGGAAGG - Intergenic
1045924850 8:107571729-107571751 CCTTATAACCAGGGGGAGAGAGG + Intergenic
1048252322 8:132877001-132877023 CATTGTAACCAGAATGTGGAAGG + Intronic
1049300578 8:141867377-141867399 CATCATCAACAGAGGCAGGACGG - Intergenic
1050069414 9:1794724-1794746 GATTATAAATAGAGGGGGGAGGG + Intergenic
1052366852 9:27621548-27621570 TATTATAACCAGTGGGGGTAAGG + Intergenic
1054315874 9:63585846-63585868 GACTATTACAAGAGGGAGGAAGG - Intergenic
1054460336 9:65458941-65458963 CATGAAAACCAGAGTGAGAAGGG - Intergenic
1055065862 9:72117672-72117694 CATTTTAACCAGTGAGATGAGGG - Intronic
1055173772 9:73292490-73292512 TGTTATAACCAGAGGCAAGAGGG + Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1058173472 9:101711072-101711094 CATTATCACAAGAAGGACGAGGG - Intronic
1059902120 9:118939501-118939523 CAAAACAACCAGAGGGGGGAAGG + Intergenic
1186567075 X:10674632-10674654 CTTTATAACCAGAATGAGCATGG + Intronic
1187949306 X:24456229-24456251 CATTATAATAAGAGGGAAAAAGG - Intergenic
1190636307 X:52437423-52437445 AATCATAAACAGAGGGAGGCTGG + Intergenic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1193273387 X:79555137-79555159 CATGAAAACAGGAGGGAGGAGGG + Intergenic
1198376715 X:136048164-136048186 GATTGTAACCAGAAGGATGAAGG + Intergenic
1198831362 X:140754241-140754263 AATTAGAACCATGGGGAGGAAGG - Intergenic