ID: 1095797749

View in Genome Browser
Species Human (GRCh38)
Location 12:46238802-46238824
Sequence AACTGAGGAGAGAAGCAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 432}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095797749 Original CRISPR AACTGAGGAGAGAAGCAATG GGG (reversed) Intronic
900819027 1:4872028-4872050 TACTGAGGAGAGAAGCTAGCAGG - Intergenic
901759534 1:11461768-11461790 TTCTGGGGAGAGAAGCAATCTGG - Intergenic
901933203 1:12610026-12610048 CAATGAGGAGAAAACCAATGAGG - Intronic
902066456 1:13692234-13692256 AAATGAGGAAAGAATGAATGTGG + Intergenic
902592388 1:17484363-17484385 GAGTGAGGAGAGAAGTGATGGGG + Intergenic
902615166 1:17619591-17619613 AGCTGAGGAGAGAACCTAGGAGG - Intronic
902622749 1:17659970-17659992 AACTGAGGCCAAGAGCAATGTGG + Intronic
902762722 1:18594155-18594177 AATTGAGGAAAGAAGCTGTGAGG - Intergenic
904250372 1:29219266-29219288 AATACAGGAGAGAAGCACTGTGG - Intronic
904389748 1:30174468-30174490 AGATGAGGAGGGAAGAAATGGGG + Intergenic
905228786 1:36498519-36498541 AACTGGGGAGAAAAACAAGGTGG - Intergenic
907727392 1:57032383-57032405 AATGGAGGAGAGAAGCACAGGGG + Intronic
908042592 1:60130770-60130792 AACTCAGGAGAGAAGCATCTGGG + Intergenic
908256878 1:62310235-62310257 AACTGAGGAGCGAACCAGAGAGG - Intronic
908290873 1:62665765-62665787 GAGTGAGGTGAGTAGCAATGAGG - Intronic
909110509 1:71470913-71470935 AAATGAGGAGAGAAGCAAAAGGG - Intronic
911217360 1:95210238-95210260 AAGTAAGGAGAGAAGAAAGGAGG - Intronic
912667175 1:111592834-111592856 AACAGAGAAGAGAGGAAATGGGG - Intronic
912830986 1:112953826-112953848 AACTTAGTATAGAAGCAATTTGG - Intronic
913060232 1:115197744-115197766 AACTGAGGAGACAGGCATTAAGG - Intergenic
913240287 1:116824422-116824444 AACTGGGGAGAGAAGTGATGAGG + Intergenic
913408794 1:118527229-118527251 AAGTGAGGAAAGAGGCTATGTGG + Intergenic
914753487 1:150550594-150550616 AGCTGAGGGAAGAAGAAATGGGG - Intronic
914906407 1:151749619-151749641 AACTGAGCAGAAAAGCAGAGGGG + Intergenic
915028866 1:152858956-152858978 AAGGGAGGAGAAAAGCCATGAGG + Intergenic
915720692 1:157983210-157983232 AAATGGAGAGAGAAGCAAGGTGG - Intergenic
915746190 1:158160095-158160117 AACTTGGCAGAGAAGCAATAAGG + Intergenic
915755746 1:158257587-158257609 GACTGGGGAGAGAAGAACTGAGG - Intronic
915834773 1:159167985-159168007 AATTGAAGAGGAAAGCAATGTGG + Intergenic
915844322 1:159247762-159247784 TAGTGAGGGGAGAAGCAAAGAGG + Intergenic
916603760 1:166320901-166320923 AACTGAGGAGAGAATCTCTGAGG - Intergenic
916716230 1:167448902-167448924 CACTGAGGAGAGAATTAAGGAGG - Intronic
916718295 1:167462961-167462983 ATCTGAGGAGACAGGCAATGAGG - Intronic
917437335 1:175034604-175034626 AAATGAGGAAAAAAGGAATGGGG - Intergenic
917827123 1:178835130-178835152 ATTTGAGGAGAGAAGGAATAGGG + Intronic
918514207 1:185344509-185344531 AACTAGGGAGAGAAGCAAAAGGG - Intergenic
918585234 1:186179590-186179612 AACATAGGAGAGAAGTAAAGAGG + Intronic
919211441 1:194492285-194492307 AAGTTTGGAGAGAAGCTATGGGG + Intergenic
919343063 1:196338308-196338330 AGCTCAGGAGAGCAGCAAAGAGG + Intronic
919354635 1:196505349-196505371 ACCTGAGAAAACAAGCAATGGGG - Intronic
920555468 1:206901072-206901094 GACTGAGAACAGAAGAAATGAGG - Intronic
920921562 1:210301716-210301738 TACTCAGCAGAGCAGCAATGTGG + Intergenic
921063719 1:211608080-211608102 AACCCAGGGGAGAGGCAATGAGG - Intergenic
921066960 1:211630317-211630339 AACTCATGAGAGAGGCAGTGTGG - Intergenic
921502273 1:215919583-215919605 ATCAGAGGAGAGATGGAATGTGG + Intronic
921951761 1:220937493-220937515 AAGAGAGGAGAAAAGCAATTGGG - Intergenic
921963825 1:221066321-221066343 AACTCAGGAGAGAAGCAAATTGG + Intergenic
923256513 1:232226042-232226064 AACTGAGGACAGTAGAAATTTGG - Intergenic
924639597 1:245821272-245821294 ACCTGACAAAAGAAGCAATGGGG + Intronic
1063027883 10:2201014-2201036 AAGTCAGGAGAGAAGAGATGGGG + Intergenic
1064329677 10:14381753-14381775 AAGTGAGGAAAGAAGCCATATGG - Intronic
1065213046 10:23423001-23423023 AAGGGAGAAGAGAAGAAATGTGG + Intergenic
1066002082 10:31114204-31114226 TTCTGAGGATAGAAGCAAAGAGG + Intergenic
1066559009 10:36647790-36647812 AAGGGAGGAGAGAAAGAATGAGG + Intergenic
1066608835 10:37212829-37212851 AACTGAAAAAAAAAGCAATGGGG - Intronic
1067939928 10:50646790-50646812 AAGTCTGGAGAGAAGCTATGGGG - Intergenic
1069034267 10:63630665-63630687 AACAGAGGGGAGAAGCAGAGGGG - Intergenic
1069804740 10:71113276-71113298 GACTGAGGTGAGAGGCATTGTGG + Intergenic
1070011612 10:72480708-72480730 AATTGTGGAGAGAGGGAATGGGG - Intronic
1071205262 10:83268137-83268159 AAATGATGAGAGAAGAAGTGAGG - Intergenic
1071817014 10:89242515-89242537 ACATGAGCAGAGAAGCCATGTGG + Intronic
1072038389 10:91585029-91585051 AAAAGAGGGGAGAAGAAATGAGG + Intergenic
1073447162 10:103588605-103588627 AAGGGAGGAGAGAAGGAAGGAGG + Intronic
1073715692 10:106104411-106104433 AAGGGAGGAGAGAGGGAATGAGG - Intergenic
1074773430 10:116748444-116748466 CCCTGAGAAGAGTAGCAATGAGG - Intergenic
1075519775 10:123136508-123136530 AACTGCGGAGGGAAGCAGCGCGG - Intronic
1075893228 10:125972218-125972240 CACTGAGGAGAACTGCAATGCGG - Intronic
1077471904 11:2767697-2767719 CACTGTGGAGAGAAGCTTTGGGG - Intronic
1077662555 11:4082670-4082692 AAGCGAGGGGAGAAGCAAAGGGG - Intronic
1078513578 11:12004917-12004939 AACAAAGGGGAGAAGAAATGGGG + Intronic
1078927935 11:15891153-15891175 AACTGAGAACAAAAGCAAAGAGG + Intergenic
1079189237 11:18264330-18264352 AACTGAGAAGAGAATGAACGAGG - Intergenic
1079323642 11:19473150-19473172 AACTGAAGCCAGAAGCTATGTGG + Intronic
1079411774 11:20194293-20194315 ATCTGGGGAGAGAACTAATGAGG - Intergenic
1081133754 11:39412259-39412281 ATCTGAGGAGTGAAGGAGTGTGG - Intergenic
1081145213 11:39555336-39555358 AACTGGGGAGAGAAGAAAATAGG - Intergenic
1083749236 11:64752382-64752404 AGGTGGGGAGAGATGCAATGTGG - Exonic
1084351189 11:68600822-68600844 AATTGAGGAGAAGAGGAATGAGG + Intronic
1084437275 11:69151057-69151079 AACTGACAAAAAAAGCAATGGGG + Intergenic
1085217370 11:74844344-74844366 GACTGAGGAATGAAGCAATCAGG - Intronic
1085669957 11:78454019-78454041 CACTAAGGAAGGAAGCAATGTGG - Intronic
1085707497 11:78799947-78799969 GGCTGAGGAGAGAGGCTATGGGG + Intronic
1085823454 11:79817797-79817819 AGCTAAGGAGAGCACCAATGAGG + Intergenic
1087516901 11:99175344-99175366 AAATGAAGAGAGAAGAAAAGAGG + Intronic
1087712991 11:101575907-101575929 AAGGGAGAAGAGAAGGAATGGGG + Intronic
1088176344 11:107056747-107056769 AACTGACAAAACAAGCAATGGGG + Intergenic
1088672897 11:112160938-112160960 AATTGAGGAGAGGAGGAATGGGG - Intronic
1089003161 11:115068801-115068823 AACTGAGGAGAGATCCAATGAGG - Intergenic
1089058455 11:115606925-115606947 CACTGAGGAGAGAGGAAATAGGG + Intergenic
1091004427 11:131939842-131939864 AAATTAGGAGAGTAGCAAGGAGG + Intronic
1091102888 11:132892161-132892183 AACTGTGTTGAGTAGCAATGAGG + Intronic
1091114515 11:133000626-133000648 AATGGAGGAGAGAAGTAATAAGG + Intronic
1093654425 12:21678016-21678038 AACTAGGGAGAGGAGCAATTTGG + Intronic
1093820849 12:23616057-23616079 AACAGAGGAGAGGTACAATGAGG + Intronic
1094707297 12:32926569-32926591 AAGTGAGGAGTGAAGGAGTGTGG + Intergenic
1095233166 12:39766122-39766144 AAATGAGGAGATAAACAAAGTGG - Intronic
1095264880 12:40144205-40144227 AACTGAGCCAAGAAGCAGTGAGG - Intergenic
1095511645 12:42957196-42957218 AACTGAGTAGAGAAGCGCTCAGG - Intergenic
1095797749 12:46238802-46238824 AACTGAGGAGAGAAGCAATGGGG - Intronic
1096200718 12:49680432-49680454 AAAAGAGGATAGAAGCACTGAGG - Intronic
1096431798 12:51550516-51550538 AAGTGATGAGAGAAGCCAAGAGG + Intergenic
1096996633 12:55842337-55842359 CTCTGAGGTGAGAAGCTATGAGG - Exonic
1097167190 12:57092153-57092175 AGCTGAGGATGGAAGCACTGCGG - Intronic
1097602488 12:61710981-61711003 ATCTGAGGAAAGAAACAATAAGG + Intronic
1097623805 12:61975294-61975316 AAGTGAGGGAAGAAGGAATGGGG - Intronic
1098408867 12:70157503-70157525 GACTGAGGAGACAAGGTATGAGG - Intergenic
1100818854 12:98412348-98412370 AATTGAGTAGTAAAGCAATGGGG + Intergenic
1101383996 12:104239781-104239803 AACTGAGTCAAGAAGAAATGAGG - Intronic
1101467721 12:104964869-104964891 AACTAAGAAGACAAGAAATGAGG + Intergenic
1101765193 12:107691525-107691547 AAATTAGGCCAGAAGCAATGAGG + Intronic
1102513015 12:113428399-113428421 ATCTGGGAAGAGAAGGAATGGGG - Exonic
1104441549 12:128797405-128797427 AACTAAGGAGAGAGGCAAGGAGG + Intronic
1106292462 13:28377227-28377249 AACTGAGTAAAGAAGCAACTGGG - Intronic
1106313482 13:28574192-28574214 AACTTAAGAGAGAAGCGGTGGGG - Intergenic
1107042593 13:35965652-35965674 AAAAGAGGAGAGGAGCAATGTGG - Intronic
1107124528 13:36831993-36832015 AGCTGAGCAGAGAAGAAATGAGG + Intergenic
1108985113 13:56576939-56576961 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1110061350 13:71041930-71041952 AAGTGAGGAGAAAAGGAAAGTGG + Intergenic
1110169073 13:72478876-72478898 AACTGAGCAGTGAAGCCATCAGG - Intergenic
1110324683 13:74200286-74200308 ACCAGAGGATGGAAGCAATGAGG + Intergenic
1110646894 13:77896768-77896790 AACGGAAGAGAGAGGAAATGAGG - Exonic
1111533825 13:89575714-89575736 TACTGAGGAGAGGAGGAAGGAGG - Intergenic
1111887305 13:94038711-94038733 CACTGAGGGCAGAAGAAATGTGG + Intronic
1111949389 13:94698756-94698778 AACAGAGAAGAGAAAAAATGAGG + Intergenic
1112422492 13:99265320-99265342 AACTGAGAAGGGAAGGAAGGAGG + Intronic
1112607147 13:100917645-100917667 GATGGAGGAGAGATGCAATGGGG + Intergenic
1112992752 13:105534130-105534152 AACAGAGGAGAGTATCCATGGGG + Intergenic
1113649529 13:112026227-112026249 AGCTGAGGACAGAAGAAATAGGG - Intergenic
1114081286 14:19203163-19203185 ATCTGAGTATAGAAGCACTGAGG - Intergenic
1114191363 14:20441711-20441733 ACCTGAAAGGAGAAGCAATGAGG - Intergenic
1114565195 14:23626516-23626538 AACTGTGTAGACAAGCTATGAGG - Intergenic
1114970880 14:28026981-28027003 AACAGAAGAGAGAAGGAAGGAGG + Intergenic
1115151388 14:30290037-30290059 AAATAAGGTGAGAAGCAATCAGG - Intergenic
1115865456 14:37741822-37741844 AGCTGAGGAGGGAAGCAACAGGG - Intronic
1117189959 14:53279737-53279759 AACTGAGGCCAGGAGCAGTGTGG + Intergenic
1117247277 14:53898733-53898755 GACTGAGCAAAGAAGCAAAGAGG + Intergenic
1117504109 14:56384492-56384514 AACTGAGCAGTGAAGCCATCAGG + Intergenic
1117753001 14:58943148-58943170 TACTCAGGAGAGAAGTAAAGAGG + Intergenic
1117789149 14:59320563-59320585 CACTGAGGACAAAACCAATGAGG + Exonic
1118439953 14:65803206-65803228 AACTGAGGAGAGGTGCAAGGAGG + Intergenic
1118623624 14:67636739-67636761 CACTCAGGAGAGAAGCAACAAGG + Intronic
1120043177 14:79776693-79776715 AACTGAGAAGACAAAGAATGTGG + Intronic
1120072916 14:80123455-80123477 AACTCATGAGAGCAGCCATGGGG + Intergenic
1120628785 14:86862924-86862946 ATCTGAAGAGAGAAGAAAAGGGG + Intergenic
1121215509 14:92244635-92244657 AACTCATGAGAGCAGCCATGGGG - Intergenic
1121857760 14:97285810-97285832 AAGTGAGTAGAGCAGCATTGAGG - Intergenic
1125325198 15:38529360-38529382 AGGTGTGGAGAGGAGCAATGTGG - Intronic
1125441143 15:39704969-39704991 AACTGAAAAGAGAAAGAATGTGG + Intronic
1125633288 15:41166179-41166201 AACAGTAGAGGGAAGCAATGGGG + Intergenic
1127741085 15:61906514-61906536 ATGTGAGGAGAGAAGAAATGAGG + Intronic
1127778873 15:62293932-62293954 AGCTGAGAAAACAAGCAATGGGG + Intergenic
1127865163 15:63026638-63026660 AACTGAGGAGCACAGCTATGGGG - Intergenic
1127938685 15:63670569-63670591 AAATGAAGACAGAAGAAATGAGG + Intronic
1128026347 15:64440575-64440597 AACAGAGGTGAAAAGCAAAGTGG - Intronic
1128104305 15:65031762-65031784 AACAGAAAAGAGAAGCAAAGAGG + Intergenic
1128637012 15:69309124-69309146 AGGTGATGAGAGAAGCCATGGGG + Intronic
1128755217 15:70179061-70179083 AACTGAGTGGAGAAGGAGTGTGG + Intergenic
1128899739 15:71409375-71409397 AGCTGGGGAGAGAGGGAATGGGG + Intronic
1130064112 15:80590812-80590834 AACTGTAGACAGAAGCAAAGTGG + Intronic
1131320455 15:91384845-91384867 ATTTGAGGAGAGAAGAGATGGGG - Intergenic
1131419881 15:92296347-92296369 AACAGAGCAGATAAGCAAAGAGG - Intergenic
1132884766 16:2177824-2177846 AACTTAGGAGAGAAGCACGGAGG + Exonic
1133111340 16:3549905-3549927 AGATGAGAAGAGAAGCAGTGTGG - Intronic
1133366818 16:5216758-5216780 TACAGAGCAGAGAAGAAATGAGG - Intergenic
1133740311 16:8646405-8646427 AACTGAGCTGAGAAGGAACGTGG - Exonic
1133820182 16:9229057-9229079 GACTGGGGAGGGAGGCAATGGGG + Intergenic
1135501686 16:23001229-23001251 ATCCGAGGAGAGAGGCATTGAGG - Intergenic
1135584605 16:23659361-23659383 CAAGGAGGAGAGAAGCAAAGAGG - Intronic
1136156901 16:28389066-28389088 ACCTGAGGTGAGATCCAATGAGG - Intronic
1136206185 16:28726215-28726237 ACCTGAGGTGAGATCCAATGAGG + Intronic
1136428256 16:30183365-30183387 CAGGGAGGAAAGAAGCAATGGGG + Intronic
1139516768 16:67457007-67457029 AGCTAGGGAGAGAAGCCATGTGG - Intronic
1140240220 16:73193352-73193374 AACTGAGGAAAGGAGAGATGGGG + Intergenic
1141255216 16:82395838-82395860 AAGTGAGGAGAGGAGAGATGAGG - Intergenic
1142356217 16:89603453-89603475 CACTGTGCAGAGAAGCACTGGGG + Intergenic
1143512468 17:7404287-7404309 AACAGAGGAGCTAAGCAGTGGGG + Intergenic
1144376514 17:14647721-14647743 AAAAGAGGAGAGAAGGAAAGGGG - Intergenic
1144463275 17:15475729-15475751 AACTCAAGAGAGAAAGAATGTGG + Intronic
1145358955 17:22195276-22195298 AACTGTGGCCAGAAGCACTGTGG + Intergenic
1146848254 17:36198936-36198958 AACGGAGGACAGAAGCCAAGTGG + Intronic
1148318021 17:46721383-46721405 AACTGAAGAAGGAAACAATGTGG - Intronic
1150555249 17:66248509-66248531 GACTGATAAGGGAAGCAATGAGG + Intronic
1150942819 17:69711727-69711749 AACGCAGAAGAAAAGCAATGTGG + Intergenic
1151534628 17:74731638-74731660 AACTGAGGAGAGAGGTAACAAGG - Intronic
1153542271 18:6168553-6168575 ACCTGAGAAAAAAAGCAATGGGG + Intronic
1153624247 18:7008165-7008187 CACTGGGGAGAGAGGAAATGGGG + Intronic
1153947226 18:10028776-10028798 GAGTGGGCAGAGAAGCAATGAGG - Intergenic
1155173129 18:23281908-23281930 ATCTGATGAAAGAAGGAATGAGG + Intronic
1155221910 18:23692766-23692788 AAATGAGGAGAGAATCAAAATGG - Intronic
1155756710 18:29507370-29507392 TACTCTGGAGAGAAACAATGTGG - Intergenic
1156410322 18:36821989-36822011 AGATGAGGAGAGAACAAATGGGG + Intronic
1156819987 18:41360660-41360682 GAATAAAGAGAGAAGCAATGTGG + Intergenic
1158354719 18:56605275-56605297 AGATGAGCAGAGAAGCAAGGAGG + Intronic
1159392033 18:67806062-67806084 AAATGAGGAGAGAAATACTGTGG + Intergenic
1159549681 18:69881387-69881409 GACTGAGGAGAAAAGCCTTGGGG + Intronic
1159602361 18:70440803-70440825 AAGTGTGGACAGAAGCAAAGAGG - Intergenic
1159810809 18:73016218-73016240 GACGGACGTGAGAAGCAATGTGG - Intergenic
1159985924 18:74840894-74840916 AACTGAGAAGAGATCCCATGAGG - Intronic
1160432940 18:78824747-78824769 AACTGAGAACAGAAGCAATTGGG + Intergenic
1164641846 19:29832016-29832038 AACCGAGGGGAGATGAAATGAGG + Intergenic
1164882297 19:31742585-31742607 AAGTAAGGAGAGAAGGAAGGAGG + Intergenic
1164947571 19:32309409-32309431 CAATGAGGAGAGATGCAGTGTGG + Intergenic
1166295761 19:41888511-41888533 AAATTAGGAGAGAAGAAATTGGG - Intronic
1166333878 19:42093894-42093916 ACCTGAGGAGAGAAGAAAGGAGG + Exonic
1166523148 19:43494927-43494949 AACTAAGGAGAGATGGAATGTGG + Intronic
1167471779 19:49679675-49679697 AAGTGAGGGGAGAAGAAAGGGGG - Intronic
925172529 2:1759291-1759313 GGCTGAGGAGAGAAGGCATGTGG - Intergenic
925185814 2:1845577-1845599 AGGTGAGGAGAGCAGCAATGGGG - Intronic
925261125 2:2529590-2529612 AGCTGAGGAGAGATGAGATGTGG + Intergenic
926071108 2:9892471-9892493 AGCTGAGGAGGGAGGGAATGCGG - Intronic
926965056 2:18400799-18400821 AAGTGAGGTGAGAAGGAATGAGG + Intergenic
926985862 2:18622540-18622562 AAATGAGGAGAGAAGAAAATAGG - Intergenic
928673173 2:33622983-33623005 AATTGAGAAGAGAAGAAATATGG + Intergenic
928844960 2:35660243-35660265 GTCTGAGGAGAGAAAGAATGAGG - Intergenic
929388940 2:41445365-41445387 GACTCAGGAGAGAAGCAGAGGGG + Intergenic
930917811 2:56715272-56715294 AACCAAGGAGGAAAGCAATGGGG - Intergenic
931846661 2:66211099-66211121 ACCTGAGAAAACAAGCAATGGGG + Intergenic
932668683 2:73718507-73718529 AATTAAGGAGCCAAGCAATGAGG - Intergenic
932891513 2:75600976-75600998 ACCTGAGAAGAGAAGCCTTGAGG - Intergenic
934914251 2:98286827-98286849 AACTGAAAAGAGAAGCCATAGGG - Intronic
934975445 2:98799098-98799120 AACTGAGGAGAGGTGCCAGGTGG - Intronic
935328299 2:101958119-101958141 AATTGAAGAGAGAAGAAATAGGG - Intergenic
936060854 2:109294888-109294910 TAGTGAGGAGAGAAGCAGGGAGG + Intronic
936155914 2:110047461-110047483 TGCTGGGGAGAGAAGCAAGGAGG - Intergenic
936188774 2:110323967-110323989 TGCTGGGGAGAGAAGCAAGGAGG + Intergenic
936607009 2:113968910-113968932 AACTGAGGAGACATACTATGTGG - Intergenic
936977282 2:118232590-118232612 CACTCAGCAAAGAAGCAATGAGG + Intergenic
937815243 2:126243929-126243951 AACTGCCCAGAGAAGCCATGAGG - Intergenic
940106682 2:150109090-150109112 AACTGAGCAGATAAACAATGAGG - Intergenic
941146557 2:161854080-161854102 GACTAAGGAGAAAAGGAATGAGG + Intronic
941302685 2:163823776-163823798 AATTCAGGAGAGAAGCCATTTGG + Intergenic
941762756 2:169262971-169262993 ACCTGAGAAAAAAAGCAATGGGG + Intronic
942051157 2:172142263-172142285 AACTGAGAAGTGAAGGAGTGGGG - Intergenic
942193761 2:173497018-173497040 AACTTAGGACAGAAGGAATCTGG - Intergenic
942601059 2:177641561-177641583 AACTGGGGAGGGAAGGAGTGAGG - Intronic
943742239 2:191422321-191422343 AACTGAGGATAGCATCACTGGGG - Intronic
943777688 2:191784874-191784896 AAGGGAGGAGAGCAGCAGTGAGG - Intergenic
944354985 2:198777053-198777075 AACTGAAGAGAGCAGCAATTGGG - Intergenic
945510996 2:210702649-210702671 AAGTGAGAAGAAAAGCACTGTGG + Intergenic
945512413 2:210719034-210719056 AACTGAGGAGTGACGAGATGAGG - Intergenic
946040615 2:216780375-216780397 AACTGAGGGTGGAAGCCATGAGG + Intergenic
946485648 2:220098575-220098597 AACTCAGGACAGAAGCCAGGAGG - Intergenic
947756127 2:232566660-232566682 GACTAGGGAGAGAAGAAATGGGG - Intronic
948666597 2:239538631-239538653 AACCCTAGAGAGAAGCAATGGGG + Intergenic
1168829376 20:836353-836375 CACTGGGGGGAGAGGCAATGGGG - Intronic
1168916743 20:1494773-1494795 AAATGAAAAGAGAAGAAATGAGG - Intergenic
1169853393 20:10077629-10077651 AACAGAGGAGAGACACCATGTGG - Intergenic
1171149078 20:22810863-22810885 AAGTGAGGAGAGACGCCAGGTGG - Intergenic
1172082450 20:32352840-32352862 AACTGAGGCCAGAAGCATTATGG + Intergenic
1172783011 20:37448204-37448226 AACTGAGGACAGACGGACTGAGG + Intergenic
1173419591 20:42889203-42889225 AGCAGAGGGGAGAAGCAAGGTGG - Intronic
1174151399 20:48488925-48488947 AACAGAGGAGGGAAGGATTGGGG - Intergenic
1174251474 20:49223010-49223032 AACAGAGGTGAGAAGAAAAGTGG + Exonic
1174330082 20:49811180-49811202 AACTGGGTAGAGAAGAAATCTGG - Intergenic
1175168057 20:57060265-57060287 ATCTCAGGACAGAGGCAATGGGG + Intergenic
1175848783 20:62075422-62075444 AAGAGAGGAGAGAAGAAATGAGG + Intergenic
1176909001 21:14540018-14540040 ACCTGAGAAAACAAGCAATGGGG + Intronic
1177580648 21:23018061-23018083 AATTGGGGAGAGAAACTATGAGG - Intergenic
1177648693 21:23933486-23933508 AACAAAGGAAAGAAGGAATGAGG - Intergenic
1177925101 21:27204288-27204310 AACTGAGCAGAGATGTGATGAGG - Intergenic
1178290906 21:31367119-31367141 AAGTAAGGAGAGAAGGAAGGAGG + Intronic
1178418323 21:32422236-32422258 AGCTGAAGAGAGAAACAGTGAGG + Intronic
1180499486 22:15919523-15919545 ATCTGAGTATAGAAGCAGTGAGG + Intergenic
1180881084 22:19203912-19203934 GTGTGAGGAGAGAAGCAGTGAGG - Intronic
1181773250 22:25141993-25142015 AAATGAGGAGAGATGGGATGGGG + Intronic
1182861509 22:33563359-33563381 AAATGAGGAGATGAGTAATGAGG - Intronic
1184030522 22:41891780-41891802 AACTGAGGACAGAAGACAGGAGG - Intronic
1184862787 22:47184300-47184322 AATTCAGCAGTGAAGCAATGAGG - Intergenic
1185116262 22:48940000-48940022 TACTGGGGAGGGAAGGAATGCGG + Intergenic
1185215531 22:49597969-49597991 AATGGAGGACAGAAGGAATGAGG - Intronic
949280645 3:2342916-2342938 AACTAAGGAGAGATGCAAGCGGG + Intronic
951655358 3:25001413-25001435 CACTCAGCAGAGTAGCAATGTGG + Intergenic
953087395 3:39683393-39683415 AAGTGAGGAGAGAAGCCAAGTGG + Intergenic
953137509 3:40194910-40194932 AACTGAGAAGAGAATCCATTAGG - Intronic
953666694 3:44930703-44930725 ACCTGAGGAGATATGCATTGTGG - Intronic
954525460 3:51266554-51266576 ACCTGACAAAAGAAGCAATGGGG + Intronic
954790028 3:53125477-53125499 CACTGAGGAGGGAAGGAAGGTGG + Intronic
954865479 3:53725581-53725603 CACTGAGGGGAGAGGCAGTGAGG - Intronic
954983903 3:54772247-54772269 AACTGATGAGTCAAGCAAAGAGG - Intronic
955506277 3:59636275-59636297 AACAGAGGCCATAAGCAATGGGG + Intergenic
956516318 3:70052376-70052398 AACAGGGGAGAGAAGAGATGAGG - Intergenic
957104608 3:75870283-75870305 AGGTGAGGAGTGAAGGAATGAGG + Intergenic
957902288 3:86510206-86510228 GGCTGAGGAGAGGGGCAATGGGG + Intergenic
959878966 3:111420722-111420744 GAATGACAAGAGAAGCAATGAGG + Intronic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960343273 3:116501306-116501328 AACTGAAAAAACAAGCAATGGGG + Intronic
961532322 3:127547314-127547336 AACTCAGGAGGGAAGGATTGGGG + Intergenic
961698624 3:128724611-128724633 AACAGAGGAGAAAAGCAGTAGGG + Intergenic
961737083 3:129009155-129009177 AACAGAGGAGAGAAGAAAGGTGG - Intronic
962043961 3:131736061-131736083 AACTGTGGAGAGAAGGCAGGGGG - Intronic
962074844 3:132070776-132070798 CACTGAGGAGAGGAGCAGTGTGG - Intronic
963467114 3:145697520-145697542 TACTGAGAAGAGGAGCAGTGGGG + Intergenic
964241071 3:154595349-154595371 ACCTGAGAAAACAAGCAATGGGG - Intergenic
966473549 3:180319384-180319406 AAGTGAGGAGAGCACCAAGGAGG - Intergenic
967522884 3:190455234-190455256 AACTGAGGAGGTAAGCCATATGG - Intergenic
967940829 3:194765154-194765176 AACGGAGGAAAGAAGAAAGGAGG + Intergenic
968208140 3:196823039-196823061 ATCTGAGCAGAGAAGCAAAGTGG + Intronic
968311418 3:197686639-197686661 AACTGAGGAGTGAAGAGAGGGGG + Intronic
969234011 4:5852488-5852510 AAAAGAGGAGAGAAGCAGGGAGG - Intronic
969430529 4:7151261-7151283 AACTGAGCTGAGATGCCATGGGG - Intergenic
969668871 4:8578625-8578647 ATCTGAGGCCAGAAGCACTGGGG + Intronic
969914718 4:10478984-10479006 AACTCAGGTGAGAAGCAAGCAGG - Intergenic
970169424 4:13274994-13275016 GACTGAGGAGAGGAGAAGTGGGG - Intergenic
970475823 4:16421869-16421891 ACCTGAGAAAACAAGCAATGGGG + Intergenic
971161936 4:24142319-24142341 AACTGTGGAGAAAAACAAGGTGG + Intergenic
971385475 4:26137502-26137524 TACTATGGAGAGAAGCAGTGTGG + Intergenic
971767217 4:30848499-30848521 AGATGAGGACAGATGCAATGAGG + Intronic
971832991 4:31722123-31722145 AACTAAGGTGAGAAGTAATTAGG + Intergenic
973722505 4:53739512-53739534 ACCTGAGAAAACAAGCAATGGGG + Intronic
975528222 4:75374267-75374289 AACTGTGGAGACAAGGTATGAGG - Intergenic
975723751 4:77272418-77272440 AACTGAGATGAGAAGCTGTGGGG + Intronic
976200282 4:82571133-82571155 AACTGAGAAGCTAAGCAGTGAGG + Intergenic
978084710 4:104636473-104636495 AACTCAAGAGAAAAGTAATGAGG - Intergenic
978705326 4:111702237-111702259 AATTGAGGAGAGAATCAGAGTGG - Intergenic
979728784 4:123996537-123996559 AAAAGAGGAAAGAAGCAGTGTGG - Intergenic
979998266 4:127459385-127459407 ACCTGACAAAAGAAGCAATGGGG - Intergenic
980194525 4:129571509-129571531 AAGGGAGAAGAGAAGCAATTTGG + Intergenic
981399749 4:144300572-144300594 AATTGAGGAAAAAAGCAAAGAGG - Intergenic
981960468 4:150531407-150531429 AAGTGAGGGAAGAAGCCATGAGG - Intronic
984770212 4:183430761-183430783 AAGGGAGGAGAGAGGCAGTGGGG - Intergenic
984777029 4:183490736-183490758 GAGTGAGGAGAGAAAAAATGGGG + Intergenic
985319190 4:188689979-188690001 AACTGAATAAAGAAGTAATGTGG - Intergenic
985383571 4:189421344-189421366 ATTTGTGGAGAGAAGAAATGAGG + Intergenic
986143215 5:5050939-5050961 AACAGAGGAAAGAGGCAGTGAGG - Intergenic
986247620 5:6025117-6025139 ACCTCAGGAGAGAGGCAATGCGG + Intergenic
986592166 5:9382364-9382386 AACTGAGGGGAAAAGCTATTAGG + Intronic
987092679 5:14521976-14521998 GACTGAGGAGAGAACACATGGGG - Intronic
987280272 5:16406754-16406776 AACTGAGAAGTTAAGCCATGTGG - Intergenic
988131164 5:27108199-27108221 TTCTGAGGAGAGAAGAACTGAGG - Intronic
988389233 5:30605985-30606007 AAATAAGGAGAGAAGCTATTGGG + Intergenic
988855066 5:35220265-35220287 ACCCGAGGTAAGAAGCAATGAGG - Intronic
989858988 5:46341629-46341651 ACCTGAGAAAACAAGCAATGGGG - Intergenic
990715438 5:58631299-58631321 AACTGAGTGGAGAAGCCATTGGG + Intronic
991533356 5:67639225-67639247 AACAGAGGAGGGAAGCAAGGCGG - Intergenic
994397860 5:99240986-99241008 AAATGATGAGAGGAGCAAGGAGG + Intergenic
994668685 5:102739428-102739450 AACTGAGTACAGAAGCAAATAGG - Intergenic
996214884 5:120854390-120854412 AAATGAAGGGACAAGCAATGAGG - Intergenic
996497548 5:124178372-124178394 TACTGAGGAGAGAAGAGATGTGG - Intergenic
996695978 5:126395445-126395467 GGCTGGGGAGAGAAGCAATGGGG + Intronic
997637078 5:135419869-135419891 AAAAGAGGAGAGAAAAAATGAGG - Intergenic
997782541 5:136674842-136674864 CACTGAGGAGGGAGGCAAGGTGG + Intergenic
998270575 5:140702837-140702859 AACTGGACAGAGAAGCAGTGGGG - Intronic
998574180 5:143295458-143295480 ACCTGAAGAGAGAAGCAGTAAGG + Exonic
998856630 5:146400568-146400590 GGATGAGGAGAGAAGCAGTGTGG - Intergenic
999306502 5:150522838-150522860 AAATGAGGGGAGGAGCCATGTGG + Intronic
1000094999 5:157963985-157964007 AACAGAGTGAAGAAGCAATGAGG - Intergenic
1000400371 5:160820428-160820450 AACTCAGCAGTGAAGCCATGAGG - Intronic
1000441139 5:161264911-161264933 AACTGAGGAGAGATGTGATTGGG + Intergenic
1000943451 5:167391765-167391787 AACTAAGTAGAAAGGCAATGTGG + Intronic
1001179277 5:169503475-169503497 AACAGAGGAGAGGAGGACTGGGG - Intergenic
1001335111 5:170790425-170790447 ATCTGAGGGGAGGAGCAAGGAGG - Intronic
1001449866 5:171816359-171816381 AGCTGAAGGGAGAAGAAATGGGG - Intergenic
1001673855 5:173496408-173496430 CACTGTGGGGAGAAGCACTGAGG + Intergenic
1004041047 6:11975932-11975954 CTCTGAGAAGAGAAGCATTGTGG - Intergenic
1004083087 6:12415418-12415440 AAGTGAGAAGAGAGACAATGAGG + Intergenic
1005268572 6:24139254-24139276 TACTAAGAAGAGAAGCCATGTGG + Intronic
1005435573 6:25807667-25807689 AACTGGGGAGCTAAACAATGAGG - Intronic
1005611327 6:27528159-27528181 AGCTGAGGAGAAAAGAAATAGGG - Intergenic
1006022402 6:31125183-31125205 TGCTGAGGAGAGAAGGAAAGGGG + Intronic
1006059428 6:31409504-31409526 ATCTGATAAGAGAAGCTATGTGG - Intronic
1007454238 6:41963866-41963888 AAGTGAGGAAAGGAGCTATGTGG - Intronic
1008571347 6:52820078-52820100 AGCTGGAGAGAGAAGCAGTGAGG - Intergenic
1008810922 6:55497899-55497921 AACTGAGGAGGGAGACAATGAGG + Intronic
1009372098 6:62917814-62917836 AAGTGGGGAGAGAAGGAGTGAGG + Intergenic
1009990601 6:70838718-70838740 AACAGAGGAGACAAGGAAGGAGG + Intronic
1010040619 6:71378646-71378668 AGCTGAGGGGAGAGGCACTGTGG + Intergenic
1010095249 6:72035545-72035567 AAAAGATGAGAGAAGAAATGGGG - Intronic
1010450889 6:76001594-76001616 ACCTGTGTAGAGAAGAAATGAGG + Intronic
1010582427 6:77616067-77616089 AACTCAGCAGAGAAGCCATGGGG + Intergenic
1011712784 6:90071566-90071588 AATTGAAAAGAGAAGCAATGGGG - Intronic
1011930081 6:92700907-92700929 CAATGAGGAGAGAAGAACTGTGG - Intergenic
1012289008 6:97427827-97427849 AGCTGAGGAAACAAGCAGTGAGG + Intergenic
1012519437 6:100103304-100103326 AACTGAGGTGAGTAGGAATCCGG + Intergenic
1013834667 6:114319909-114319931 AAAGGATGAGAGAGGCAATGAGG - Intronic
1014137379 6:117906100-117906122 AACAGAGGAGAAAAGGAATATGG - Intergenic
1014245535 6:119064329-119064351 ATATGAGGAGAGAAGCAGTCAGG - Intronic
1015051054 6:128840417-128840439 AACTAGGGAGAGAAGCAGTAGGG + Intergenic
1015380750 6:132565122-132565144 AACTATGGAGAGATGCAACGTGG + Intergenic
1016612834 6:146011818-146011840 AGCTGACAAAAGAAGCAATGGGG - Intergenic
1016623535 6:146140029-146140051 AAGAGAGGAAAGAAGCAAAGGGG - Intronic
1018096169 6:160389017-160389039 AACCAAGGAGAGAAGCCAAGGGG + Intronic
1019978539 7:4604396-4604418 AATGGAGAAGAGAAGCAATGCGG - Intergenic
1020142502 7:5620433-5620455 CATTGGGGAGAGAAGCACTGGGG - Intronic
1021290608 7:18839353-18839375 AACAGAAGAGAGTAGCAATGTGG - Intronic
1021586677 7:22216093-22216115 AACTGAGGAGGGAGTAAATGTGG - Intronic
1021748345 7:23767473-23767495 CACCCAGGAGAGAAGCAAAGAGG - Intronic
1021979864 7:26043921-26043943 AGCTGAGAAGAGAAGCTCTGTGG - Intergenic
1023492459 7:40758599-40758621 AGCTGAGGAGAGAAGCAATAAGG - Intronic
1024089752 7:45925486-45925508 AACTAAGGAGACAAGGTATGTGG - Intergenic
1024217489 7:47259675-47259697 CAAAGAGGAGAGAAGCAAGGAGG + Intergenic
1024361008 7:48468339-48468361 GACAGAGGAGAAAAGCTATGAGG - Intronic
1025630115 7:63263829-63263851 TTAGGAGGAGAGAAGCAATGGGG - Intergenic
1025854322 7:65264665-65264687 ATCTCACCAGAGAAGCAATGGGG + Intergenic
1029238470 7:99142957-99142979 AAAAAAGGAGAGAAGCAAGGGGG + Intronic
1029360343 7:100083774-100083796 AACTAAGAAGATAAGAAATGAGG + Intergenic
1029942352 7:104493754-104493776 AGCTCAGGAGAGAAGTAAGGAGG - Intronic
1032513434 7:132490059-132490081 AGCTGGGGAAAGGAGCAATGGGG + Intronic
1032579999 7:133095532-133095554 AACTGTGGAGAGAAACCAAGGGG + Intergenic
1032582104 7:133112941-133112963 ACTGCAGGAGAGAAGCAATGTGG - Intergenic
1032662373 7:133999009-133999031 AACTGAGGGGAGAAACACTGAGG + Intronic
1033349079 7:140547102-140547124 CACAGAGGAGAGAAGAATTGGGG - Intronic
1034055700 7:148032716-148032738 AGCAGAAGAGAGAACCAATGAGG + Intronic
1034659618 7:152758094-152758116 AACTGAAGAGAGAAGCAAATGGG - Intergenic
1034978448 7:155461123-155461145 CACTGAGGAGAAGAGGAATGTGG - Intronic
1035038093 7:155908389-155908411 AAATGAGGAGAGGAGAACTGAGG - Intergenic
1035818434 8:2565528-2565550 ATCTGAGGAGGCAAGAAATGAGG - Intergenic
1035937492 8:3857762-3857784 ATGTGAAGAGAGATGCAATGGGG + Intronic
1035977781 8:4332171-4332193 AACTGTGGACAGAAATAATGAGG + Intronic
1036006225 8:4666431-4666453 AGCACAGGAGACAAGCAATGTGG + Intronic
1036955143 8:13179873-13179895 GACTCAGGAGAGAAGGAATGAGG + Intronic
1036955860 8:13187683-13187705 GACTCAGGAGAAAAGGAATGAGG + Intronic
1036969099 8:13334206-13334228 CACAGAGGAGAGAAGCAGGGGGG + Intronic
1037269432 8:17110416-17110438 GACTGAGGAGAGAAGGAAACGGG - Intronic
1038842526 8:31198327-31198349 GACTGATGAAACAAGCAATGCGG - Intergenic
1040319542 8:46285710-46285732 GGCAGAGGAGAGAAGCAGTGAGG - Intergenic
1040320329 8:46291145-46291167 GGCAGAGGGGAGAAGCAATGAGG - Intergenic
1040342693 8:46448881-46448903 TGCAGAGGAGAGAAGCAGTGAGG - Intergenic
1041188032 8:55322064-55322086 CACTGAGGAGACAAGCAAGGTGG - Intronic
1042212812 8:66398443-66398465 AACTAATGAGAGAGGAAATGGGG + Intergenic
1043215221 8:77577628-77577650 AACTCAGGAGTGAAGCCATCAGG - Intergenic
1043272809 8:78355375-78355397 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1043452832 8:80385250-80385272 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1044003678 8:86916147-86916169 TCCTGAGGAGACAAGCATTGAGG - Intronic
1044163014 8:88944458-88944480 AAAGAAGGAGAGAAGCAGTGAGG - Intergenic
1045492795 8:102682941-102682963 AACTGGGGCGAGAAGCCAAGTGG - Intergenic
1046534073 8:115485871-115485893 AAATCAGGAGAGAAGAAAAGAGG + Intronic
1046656690 8:116902373-116902395 AACTAAGGAGACAAGAACTGAGG + Intergenic
1047194011 8:122705016-122705038 AAGTGAAGAGACAAGCTATGTGG + Intergenic
1047757068 8:127926958-127926980 AACGGAGGAGGGAAGGAAGGGGG - Intergenic
1049553114 8:143269764-143269786 AACTCAGGAAAGAAACAATGCGG - Intronic
1049702009 8:144019615-144019637 AGCTGGGGAGACAAGAAATGAGG + Intronic
1049905331 9:211410-211432 AAATGAGCAGAGAAGAAATATGG + Intergenic
1050795174 9:9530525-9530547 AATTCAGCAGTGAAGCAATGTGG - Intronic
1054812560 9:69446634-69446656 ACCAGAGGAGGGAAGCAGTGAGG - Intronic
1056084714 9:83135078-83135100 AACTGGGGAGAGGGGTAATGGGG + Intergenic
1056257795 9:84818153-84818175 AACTGAGGAATGGAGCCATGAGG + Intronic
1056735726 9:89208108-89208130 GACAGAGGAGAGAAGATATGAGG - Intergenic
1058384204 9:104414599-104414621 AACTGTGTAGACAAGCAATGAGG - Intergenic
1059488883 9:114650432-114650454 AAATGTTGAGAGCAGCAATGGGG - Intergenic
1059700130 9:116767793-116767815 AACAGAGGAATGGAGCAATGTGG + Intronic
1060380993 9:123171966-123171988 CACTCAAGAGAGAAACAATGTGG + Intronic
1060991216 9:127850277-127850299 AACTGGGGATAGAGGCAAGGAGG + Intronic
1061399439 9:130360376-130360398 AAAGGAAGAGAGAAGCAAGGGGG - Intronic
1061585356 9:131563838-131563860 AACTGTGAAAATAAGCAATGAGG - Intergenic
1185922763 X:4112525-4112547 GACTGAGGACAGAAGCAAAGGGG + Intergenic
1186823809 X:13317572-13317594 AATTGAGGAAAGAAATAATGTGG + Intergenic
1187476200 X:19613187-19613209 CACTGAGGAGAGAGGTAACGTGG + Intronic
1188627675 X:32306641-32306663 AAATAAGGAGAGAAACAAGGAGG - Intronic
1189578319 X:42379391-42379413 CCCTGAGGTGAGAATCAATGTGG - Intergenic
1189597710 X:42587336-42587358 AACTCAGAAGACAAGCATTGAGG + Intergenic
1190194204 X:48303542-48303564 AACTGAGCTGAAAAGCAATTGGG + Intergenic
1190324559 X:49199032-49199054 AGCTGAGGAGAGAAACAGTGGGG + Exonic
1190877147 X:54468048-54468070 GACTGAGGAGACAGGGAATGGGG + Intronic
1191573151 X:62658776-62658798 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1192014918 X:67318999-67319021 AGATGAGGATAGAAGCCATGGGG + Intergenic
1192348764 X:70336901-70336923 GACTGAGGAGAGAGGAAATGAGG - Intronic
1192427364 X:71089143-71089165 ACCTGAGGAATGAAGCATTGTGG + Intergenic
1192977024 X:76297655-76297677 GGCTGAAGAGAGAAGCAATGGGG - Intergenic
1193835995 X:86344627-86344649 GACTGTGGACAGAAGCAAAGGGG - Intronic
1193938214 X:87648959-87648981 AACTGTAGAGAGAACTAATGTGG - Intronic
1194229986 X:91309474-91309496 AACTGTGGACAGAGTCAATGTGG - Intergenic
1194609225 X:96020204-96020226 CGCTGAGGAGAGGAGCAATTGGG + Intergenic
1195716444 X:107823061-107823083 AACTGAAGGGAGAGGAAATGAGG - Intergenic
1195741013 X:108064426-108064448 AAATGAGTATATAAGCAATGAGG - Intronic
1195966809 X:110436568-110436590 TGCTGAGCAGAGAAGCAAGGGGG + Intronic
1196021791 X:110998556-110998578 AAATGAGGAGGACAGCAATGGGG + Intronic
1196354240 X:114771233-114771255 AACTGAGGCAAGCAGCAATGAGG - Intronic
1196626406 X:117881978-117882000 AACTCAGCAGAGAAGCTATCAGG - Intergenic
1197422995 X:126261616-126261638 AACTGAGTAGAGATGCATAGGGG - Intergenic
1197650382 X:129057552-129057574 AACTCAGGAGAGGAACAAAGAGG + Intergenic
1197900624 X:131367884-131367906 AAAGGAGGAGAAAATCAATGAGG - Intronic
1198889646 X:141379011-141379033 AACTCAGCAGTGAAGCCATGAGG - Intergenic
1199685635 X:150262835-150262857 GACTAAGGAGAGAAACAAGGTGG + Intergenic
1199825603 X:151496324-151496346 AATTGAGGAGTGAAGCCATCTGG + Intergenic
1201297844 Y:12479972-12479994 AATGGAGGAGAGAAACTATGAGG - Intergenic
1201491543 Y:14547301-14547323 AAGTGAGGAGAGAAAGAAGGAGG + Intronic
1201691794 Y:16775106-16775128 AATTGAGGAAAGAAGAAAGGAGG - Intergenic
1201712104 Y:17003932-17003954 GACTGGGGAGAGAGGTAATGGGG - Intergenic
1202086283 Y:21140149-21140171 AGCAGAGGAGCTAAGCAATGGGG - Intergenic