ID: 1095800374

View in Genome Browser
Species Human (GRCh38)
Location 12:46265992-46266014
Sequence GTCACTGCTCAAAGTGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 201}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095800374 Original CRISPR GTCACTGCTCAAAGTGGGAA GGG Intronic
901300199 1:8194731-8194753 GTCACTGTTCAAACAAGGAAGGG - Intergenic
901355834 1:8647875-8647897 GTTACTGTTTAAAGTGGGGAGGG - Intronic
901526332 1:9825112-9825134 GTCACTGCTCCAGGTGGGGGTGG + Intergenic
901624317 1:10615109-10615131 GTCACTGCACAGCCTGGGAAGGG + Intronic
901845748 1:11980842-11980864 GTAACTGCCCAAAGTGGGGATGG - Intronic
904385776 1:30141018-30141040 GTCTCTGCTGAAGGTGGGCATGG + Intergenic
906061224 1:42949987-42950009 GTCTCAGCTCAGAGTGGGCAAGG - Intronic
912878642 1:113388166-113388188 GTCACTGCACAGAGCAGGAACGG - Intergenic
913336647 1:117715319-117715341 GTGAATGCCCAAAGTGTGAAAGG + Intergenic
913340374 1:117752421-117752443 TTCACTCCTCAAAGTGGGTTTGG - Intergenic
913384495 1:118244468-118244490 GTCACTGCTGAACTTGGAAAAGG - Intergenic
913555886 1:119966684-119966706 GTCACTGTGAAAAGCGGGAAGGG + Intronic
913606800 1:120474835-120474857 GACACTGTTCAAAGAGGGACAGG + Intergenic
915290647 1:154880878-154880900 GTCACGCCTCAGAATGGGAATGG + Intergenic
915364422 1:155306419-155306441 GTCTCTGCTCAGTGTGGGGATGG + Intergenic
916566496 1:165983269-165983291 GTGAGTGCACAAAGTGTGAAAGG - Intergenic
919569203 1:199224470-199224492 TTCACAGCTCAGAGTGGGAAAGG + Intergenic
920038182 1:203079069-203079091 GCAGCTGCTGAAAGTGGGAACGG - Intergenic
920356124 1:205374360-205374382 GAAACTGCTCAAAATGGAAATGG + Intergenic
921533006 1:216307896-216307918 GTAAGTGCCCAAAGTGTGAAAGG - Intronic
922224330 1:223632192-223632214 GTCACTGCATGAAGTGTGAATGG + Intronic
1062830116 10:599885-599907 GTCTCTGCTCAGTGTGGGACAGG + Intronic
1063168800 10:3487373-3487395 GTCACTTCTCACAGTGTTAAAGG - Intergenic
1065595386 10:27305605-27305627 GTCACTGTTCTAAGTGATAATGG + Intergenic
1066313222 10:34218549-34218571 ATCACTGGTAAAACTGGGAAGGG + Intronic
1066577296 10:36840114-36840136 GTCACTGTTCTAAGTGCTAATGG + Intergenic
1068925169 10:62528075-62528097 GTGAGTGCCCAAAGTGTGAAAGG - Intronic
1071482738 10:86077467-86077489 GACCGAGCTCAAAGTGGGAAGGG - Intronic
1071497614 10:86179616-86179638 GTCACTGCTCCAACTGGCCACGG + Intronic
1072885086 10:99265806-99265828 GTGAGTGCCCAAAGTGTGAAAGG + Intergenic
1073044563 10:100629085-100629107 GTCACTGCTTGATGTGGGATGGG - Intergenic
1075322997 10:121507209-121507231 GTGAGTGCTCAAACTGGGACAGG - Intronic
1076407755 10:130224393-130224415 GCCATTGCTCAGAGTGGGGAGGG + Intergenic
1077061825 11:620897-620919 CTCACCGCTCAAGATGGGAAGGG + Intronic
1077938516 11:6815293-6815315 GTCACTGCTCATAGATGGCATGG + Intergenic
1079466965 11:20740283-20740305 GTCACTCCTCAAACTAGGAAAGG + Intronic
1080564041 11:33491804-33491826 GTCACTGGTCAGAGTGGAGAAGG - Intergenic
1080681796 11:34484573-34484595 GTCACTGCTGAATGAAGGAAGGG + Intronic
1081202610 11:40236053-40236075 GTCACGGCTCACAGTGGGCATGG + Intronic
1081751561 11:45514801-45514823 GTCTATGCTAAAGGTGGGAATGG - Intergenic
1084172687 11:67408275-67408297 GTCACAGATCCAAGTTGGAAAGG + Intronic
1084965293 11:72741382-72741404 GTCACCTTTCTAAGTGGGAAGGG - Intronic
1085059910 11:73435950-73435972 GTCAGTGGTCGAATTGGGAAGGG + Intronic
1085574799 11:77592625-77592647 GTCACTGATAAAATAGGGAATGG - Intronic
1087650371 11:100860272-100860294 AGCACTGCTCAAATGGGGAAGGG - Intronic
1090181766 11:124705735-124705757 GTCACAGCTCCATGTGGAAAAGG + Intergenic
1090488455 11:127136243-127136265 CTGGCTCCTCAAAGTGGGAAGGG - Intergenic
1090735864 11:129611711-129611733 GGCACTGCTCAAAGAAGAAAGGG + Intergenic
1091764931 12:3113644-3113666 GTCACTGGAGAATGTGGGAAGGG - Intronic
1091775691 12:3183297-3183319 GTCCCCTCTCAAAGTGGGGAGGG + Intronic
1091903747 12:4165763-4165785 GTCACTTCTCAAACTGTGCAGGG + Intergenic
1092056212 12:5510354-5510376 GTAACTGCTCACTGCGGGAAAGG + Intronic
1093277482 12:17148181-17148203 GTGAGTTCCCAAAGTGGGAAAGG + Intergenic
1095800374 12:46265992-46266014 GTCACTGCTCAAAGTGGGAAGGG + Intronic
1095868991 12:47004908-47004930 GTCAGAGATCAAAGTGAGAAGGG + Intergenic
1096956243 12:55529270-55529292 GTGAGTTCTCAAAGTGCGAAAGG + Intergenic
1097132021 12:56818621-56818643 GTCATTGCTCAGAGAGGGGAGGG + Intergenic
1097485493 12:60193240-60193262 GTGACTGCTCAATGCAGGAAAGG + Intergenic
1098290904 12:68956103-68956125 GTCAGTGCCCAAAGTGTGGAGGG + Intronic
1102711674 12:114933440-114933462 GTCATTCCTCATAGTGGCAATGG + Intergenic
1103352185 12:120291888-120291910 GCCACTGCGCAAAGCTGGAAAGG + Intergenic
1103365221 12:120377411-120377433 GTCAGTGCTGACGGTGGGAAAGG + Intergenic
1103877005 12:124135477-124135499 GACAATGTTCAATGTGGGAAAGG - Intronic
1104460258 12:128950109-128950131 TTCGCTTTTCAAAGTGGGAAAGG - Intronic
1106274321 13:28189623-28189645 GTCACTCCTCAAAATGAAAAGGG - Intronic
1107375244 13:39797376-39797398 GATAGCGCTCAAAGTGGGAAGGG - Intergenic
1108188837 13:47916823-47916845 GTGAGTCCTCAAAGTGTGAAGGG + Intergenic
1108620088 13:52173672-52173694 GTCACAGCTGAAATTGGTAAAGG + Intergenic
1110068265 13:71137935-71137957 GACACTGCTAAAAATTGGAATGG - Intergenic
1111864172 13:93747231-93747253 GCCACTGCTGATAGTGGCAAAGG - Intronic
1113127335 13:106994146-106994168 GTCACTGCTCAAAATGTGATTGG - Intergenic
1114332897 14:21655847-21655869 GTTACTGATTAAAGTGGTAATGG + Intergenic
1114509987 14:23250828-23250850 GGGACAGCTCAAAGTGGGAAGGG + Intronic
1116806546 14:49499560-49499582 ATCACAGCTCAATGTGGGGAAGG + Intergenic
1121788370 14:96680064-96680086 CCCTCTGCTCAAAGTGGGAAGGG - Intergenic
1124434648 15:29637083-29637105 GTCACTGTTCACCCTGGGAAGGG + Intergenic
1126974870 15:54165119-54165141 TTCACTGTTGGAAGTGGGAAAGG - Intronic
1130696216 15:86134462-86134484 GGCACTACTCAAAGTGCGAGGGG + Intergenic
1131512312 15:93056137-93056159 CTCACTACTCAAAGTGGGCCGGG - Intronic
1134098602 16:11435969-11435991 GTGAGTGCTCAAAGTTGGAGTGG - Intronic
1136183199 16:28569210-28569232 GTCACTGAACAAAGTGGTGAGGG + Intronic
1138383247 16:56618043-56618065 TTCTCTGCTCTAAGTGGGAAAGG + Intergenic
1138661077 16:58517449-58517471 TTCGCAGATCAAAGTGGGAAAGG - Intronic
1139204325 16:65012269-65012291 GCCATGGCCCAAAGTGGGAATGG - Intronic
1141398366 16:83724725-83724747 GACACTGCTCAGGCTGGGAAGGG - Intronic
1143817014 17:9525135-9525157 GGCCCTGCTCACAGAGGGAAAGG - Intronic
1144406198 17:14954952-14954974 ATCAATGTTCAAAATGGGAAAGG - Intergenic
1144527707 17:16004508-16004530 GTTGCTGCTTGAAGTGGGAAGGG + Intronic
1145178226 17:20720637-20720659 GTGGCTGCCCATAGTGGGAATGG - Intergenic
1146401435 17:32503172-32503194 GGCCCTGCACAAAGTGGGACAGG + Intronic
1147685932 17:42286980-42287002 TCCATTGCTCAGAGTGGGAAAGG + Intergenic
1148231325 17:45936980-45937002 TTCATGGCTCAAAGTGGTAAAGG + Intronic
1149837864 17:59930226-59930248 GTGGCTGCCCATAGTGGGAATGG - Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151818956 17:76486909-76486931 GGCACTGCTCAAGGTGGGGCAGG - Intronic
1161895941 19:7080410-7080432 GCCACTGCTCAATGGGGCAAGGG - Intronic
1162095679 19:8308456-8308478 GTCACTGGGGAAAGTGGGGACGG - Intronic
1165745246 19:38226734-38226756 GTCACAGCTCACCGTGGGTAAGG - Intronic
1166129522 19:40737628-40737650 GTCAGAGCTCAAGGTGGGCAAGG + Intronic
1168115440 19:54219592-54219614 GTCACTGCTGCAGGTGGGACGGG + Intronic
1168189490 19:54727378-54727400 GACACTGAGCACAGTGGGAAGGG + Intronic
927856233 2:26529664-26529686 GTCACTGCCCAGTGTGGGCAGGG + Intronic
928053328 2:28024613-28024635 GTCACTCCTCCAAGTGAAAAAGG - Intronic
929489931 2:42386946-42386968 GTCAGTGCTCAAACTGTGCAAGG - Intronic
931234660 2:60403138-60403160 GTCTCTGCTCAATGTAAGAAAGG + Intergenic
932398322 2:71463176-71463198 GTCAGTGCTCAAAGTCTGGAGGG + Intronic
933932274 2:87165561-87165583 GTGAATGCACAAAGAGGGAAGGG - Intergenic
934995307 2:98952170-98952192 GGCACTGCCTAAACTGGGAAGGG + Intergenic
936360839 2:111799874-111799896 GTGAATGCACAAAGAGGGAAGGG + Intronic
936439169 2:112535414-112535436 GTTTTTCCTCAAAGTGGGAAAGG - Exonic
938588630 2:132716064-132716086 GTCACAGCTCAGAGAGGGAAGGG - Intronic
942899387 2:181095807-181095829 GGCTCTGCTCCAAGTGGGGAAGG + Intergenic
942929119 2:181468566-181468588 GTCATTGCTCCAAGTGTGACAGG - Intronic
944065381 2:195614512-195614534 GACACTGCTCAAAGTGGGTAAGG - Intronic
944089838 2:195893847-195893869 GTCACTGCTCAAAGAGTAGAAGG - Intronic
944148229 2:196529294-196529316 GTCACTTACCAAAGTGTGAAGGG - Intronic
945199501 2:207267052-207267074 CTCACTCCCCAAAGTGGGAGTGG + Intergenic
945869669 2:215213549-215213571 ATGACTACTCAAAGTGGGGAGGG - Intergenic
946342700 2:219081425-219081447 GTCACTGCCCAAAGTGGGGAGGG + Intronic
948006988 2:234617686-234617708 GTCACTGCACAGTGTGGAAAGGG + Intergenic
1170187932 20:13612684-13612706 GTTAATGTTCATAGTGGGAATGG - Intronic
1170274625 20:14570960-14570982 ATCACTGCTCAAATTGGAATTGG - Intronic
1170335617 20:15267302-15267324 GTCTCTGCTCAAATCTGGAAGGG + Intronic
1173361472 20:42348342-42348364 GTCACTGCTCAAAGGGGAAATGG - Intronic
1174725714 20:52859641-52859663 GTGACTGATTAAAGAGGGAAGGG - Intergenic
1174732821 20:52934849-52934871 GTCACTGCTCTAAGGAGTAACGG - Intergenic
1176599118 21:8775757-8775779 GTCACTGCCCAAAGTCTGGAGGG + Intergenic
1177483806 21:21728896-21728918 GGCACTGCTCAAAGTGTAGAAGG + Intergenic
1178370250 21:32021347-32021369 TTCAGTGCTAAAACTGGGAAAGG - Intronic
1179382656 21:40913883-40913905 GTCATTGCCCAAAGTGGGAGTGG - Intergenic
1180419312 22:12799144-12799166 GTCACTGCCCAAAGTCTGGAGGG - Intergenic
1182419776 22:30243337-30243359 TTCACTGCACAAAGTGAGCAAGG + Exonic
1184962490 22:47941593-47941615 GTCTCTGCTGAATTTGGGAAAGG + Intergenic
949491521 3:4594155-4594177 GTCCCTGGTGAAGGTGGGAAAGG - Intronic
950081450 3:10225065-10225087 ATCACTGCTGCAAGTGGGACAGG - Intronic
950744526 3:15076227-15076249 GTCACTAATCAAAGTGAGGAAGG + Intronic
955392565 3:58531927-58531949 GTCACTGATCAAAGAGAGAGGGG + Intronic
957163187 3:76636666-76636688 GTCTCTTATCAAAGTTGGAATGG + Intronic
957818806 3:85342319-85342341 TTCAGTGCTCATAGTGGAAAAGG + Intronic
958016992 3:87949832-87949854 GACATTGTTCAAACTGGGAACGG - Intergenic
959346186 3:105197583-105197605 CTCAATGCTAAAAGTGTGAATGG + Intergenic
960977128 3:123186222-123186244 ATCACTGCTCAATGGGGTAAGGG + Intronic
962066113 3:131981894-131981916 GTGAGTGATCCAAGTGGGAAAGG - Intronic
962257760 3:133884072-133884094 GGCACTGCTCAAAGAGGCCAAGG + Intronic
963296178 3:143549121-143549143 GTCCCTTCTGAAACTGGGAAAGG - Intronic
963894193 3:150667731-150667753 GTCTCTCCTCAAGGTGGGGATGG - Intronic
964488487 3:157209689-157209711 GCCACCTCTAAAAGTGGGAATGG + Intergenic
964549876 3:157874224-157874246 GTCCATGCTTCAAGTGGGAAAGG + Intergenic
967829181 3:193904276-193904298 GAAACTGCTCAAAGTGTAAAAGG + Intergenic
969287354 4:6211850-6211872 GTCCCTACTAAAAGTGGGCAAGG - Intergenic
971261151 4:25057917-25057939 GGGACAGCTCAAAGTGGAAAGGG - Intergenic
971985397 4:33815667-33815689 GCCACTGGTCAGTGTGGGAAGGG - Intergenic
972075214 4:35079056-35079078 GTCACTGCCCAAAGTCTGGAGGG - Intergenic
973398625 4:49618732-49618754 GTCACTGCCCAAAGTCTGGAGGG - Intergenic
974857299 4:67476332-67476354 GTGAGTGCCCAAAGTGTGAAAGG + Intronic
975189824 4:71447211-71447233 GTCACTGCCCATATTGGGTAAGG + Intronic
984169489 4:176343512-176343534 GTCAGTGCCCAAAGTCGGATGGG + Intergenic
985799677 5:1996309-1996331 GACACTGCCCAAAGTCGGCACGG + Intergenic
985891356 5:2717584-2717606 GGCACAGCTCAAAGAGGGAAAGG - Intergenic
986321813 5:6637595-6637617 TTCACTGCTGATAGTGGGGAAGG - Intronic
987769710 5:22285115-22285137 GTCTTTACTCAAAGTGGGATAGG + Intronic
990471129 5:56116712-56116734 GTCACTGCTGGAGTTGGGAATGG - Exonic
992381448 5:76241646-76241668 GTCTATGCTGAAAGAGGGAAAGG + Intronic
993340417 5:86718526-86718548 GAAAATGCTCAAAGTTGGAAAGG + Intergenic
996025186 5:118638103-118638125 GTGAGTGCTCAAAGTGTGTAAGG + Intergenic
996185083 5:120464702-120464724 GTCCCTGCTGAAAATCGGAAAGG - Intronic
997383960 5:133458052-133458074 TTCACTGCGCAGAATGGGAAAGG - Intronic
998209473 5:140183408-140183430 GTCAACCCTCAAAGTGAGAATGG - Intronic
999080081 5:148835068-148835090 GTCACTGGGCAAAGTAGGACAGG + Intergenic
1000570613 5:162908968-162908990 GTCACAGCTCCAAAGGGGAATGG + Intergenic
1000852815 5:166361728-166361750 GTCCCTGGTGAAAGTGGGACTGG + Intergenic
1003100981 6:3176356-3176378 GTCACTGCTGCAGGTGGCAAGGG + Intergenic
1005259575 6:24043343-24043365 GTGAGTTCTCAAAGTGTGAAGGG - Intergenic
1006054244 6:31369350-31369372 GTCCCTGCACAAAGTGGCCATGG + Intergenic
1008295700 6:49773462-49773484 GTCTCTCCTGAAAGTGGTAAAGG - Intergenic
1012122327 6:95384249-95384271 GTCAGTGCCCAAAGTGTGGAGGG - Intergenic
1014153245 6:118082987-118083009 GTGGCTCCTCAAAGGGGGAATGG + Intronic
1018713833 6:166516442-166516464 GTGACTGCACACAGTGGGAGGGG + Intronic
1021717602 7:23473935-23473957 CTCACGGCTCACAGTGGGGAGGG + Intergenic
1027955777 7:84877264-84877286 GTCTCTGCTGAAAGATGGAAAGG - Intergenic
1028223611 7:88224147-88224169 GTCACAGCTTTAATTGGGAAGGG - Intronic
1030193927 7:106834895-106834917 GCTACTGCAAAAAGTGGGAAAGG - Intergenic
1031195978 7:118613927-118613949 GTCTCTCCTCAAAGAGGAAATGG - Intergenic
1031401919 7:121334923-121334945 GTAACTCAACAAAGTGGGAAGGG + Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033661357 7:143405294-143405316 GTCACTGCTGGAACTGGGAGAGG - Intronic
1034169042 7:149048578-149048600 GACACTGAGAAAAGTGGGAAAGG - Intergenic
1037862304 8:22414168-22414190 GTCACTTATCAAAGAGGGAGGGG - Intronic
1040661782 8:49583033-49583055 GTCAGTGCTCAAAGTCTGGAGGG - Intergenic
1041025291 8:53679367-53679389 GGGACAGCTCAAAGTGGGGAGGG - Intergenic
1043311747 8:78869138-78869160 TTCAATGATCAAAGTGGGGATGG + Intergenic
1043942299 8:86209722-86209744 GTCACCACACAAACTGGGAATGG + Intergenic
1044574334 8:93751936-93751958 GTAACTTCTCTAAGTGGGCATGG + Intergenic
1046376566 8:113389831-113389853 CTCACTTTTCAAAGAGGGAAGGG - Intronic
1048245943 8:132799403-132799425 GTCACTGCTCAAAGCAAGAATGG + Intronic
1048459576 8:134610447-134610469 GTGACTGCACCAAGCGGGAAAGG - Intronic
1049205168 8:141360319-141360341 GTCAGGGCTCAGAGTGGGACAGG - Intronic
1049299886 8:141863877-141863899 GTAACTGCTCACAGGGGGAGTGG + Intergenic
1051237077 9:15012725-15012747 GGCACTGCTCTAAGTGGCAGGGG - Intergenic
1055913842 9:81380090-81380112 GTCACTGCTCAGAGAGCGAATGG + Intergenic
1056058218 9:82851853-82851875 GAGACAACTCAAAGTGGGAAAGG - Intergenic
1056232298 9:84559131-84559153 TTCACTGCTCAATGTGGGGGTGG - Intergenic
1056964530 9:91154915-91154937 CTGACTCCTCATAGTGGGAAGGG - Intergenic
1058782193 9:108349132-108349154 GTCACAGCACAAAGTGACAAGGG + Intergenic
1059539436 9:115116156-115116178 GTCACTTCTTAGAGTGGGGAAGG + Intronic
1186627419 X:11309366-11309388 GACACTGCTCAAAGTGCTAGAGG + Intronic
1187048964 X:15676881-15676903 GCCACTGCTCACAGTTGCAATGG + Intergenic
1187524743 X:20044236-20044258 GGGACTGCTCAAAGCAGGAAAGG - Intronic
1189373117 X:40445583-40445605 GACACAGCTCAGTGTGGGAAAGG + Intergenic
1191017018 X:55819562-55819584 GTCAGTGCCCAAAGTGTGATGGG - Intergenic
1193774268 X:85623065-85623087 GTCCCTTATCAAAGTGTGAACGG - Intergenic
1194515869 X:94853990-94854012 GTGAGTGCCCAAAGTGTGAAAGG + Intergenic
1195002245 X:100653076-100653098 GTCAGAGCTGAAACTGGGAAAGG + Intronic
1195220209 X:102739185-102739207 GCCACTGATAAAAGTGTGAAAGG - Intronic
1196043369 X:111230107-111230129 ATCACTGCTGAAGGTGGTAATGG - Intergenic
1197569498 X:128131636-128131658 GTCACGGCTAAAAGGGGCAAAGG + Intergenic
1197958253 X:131976371-131976393 TTCACTGCTGAAAGTGCAAAAGG - Intergenic
1198997963 X:142597298-142597320 GTCACTGGATAAGGTGGGAAAGG + Intergenic