ID: 1095801222

View in Genome Browser
Species Human (GRCh38)
Location 12:46271244-46271266
Sequence CAGAGTAAACATCAACATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095801217_1095801222 10 Left 1095801217 12:46271211-46271233 CCCTTCTCTGGATTTTAGTTGAC 0: 1
1: 0
2: 2
3: 14
4: 245
Right 1095801222 12:46271244-46271266 CAGAGTAAACATCAACATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 151
1095801218_1095801222 9 Left 1095801218 12:46271212-46271234 CCTTCTCTGGATTTTAGTTGACA 0: 1
1: 0
2: 3
3: 17
4: 256
Right 1095801222 12:46271244-46271266 CAGAGTAAACATCAACATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 151
1095801216_1095801222 11 Left 1095801216 12:46271210-46271232 CCCCTTCTCTGGATTTTAGTTGA 0: 1
1: 0
2: 0
3: 15
4: 247
Right 1095801222 12:46271244-46271266 CAGAGTAAACATCAACATGGAGG 0: 1
1: 0
2: 0
3: 7
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095801222 Original CRISPR CAGAGTAAACATCAACATGG AGG Intergenic
900790959 1:4680427-4680449 CAAAGTGGACATGAACATGGGGG + Intronic
902319241 1:15648747-15648769 CAGAGTAAACACCTAGATGCAGG + Intronic
903779360 1:25811490-25811512 CAGTGAAAGCAGCAACATGGAGG + Exonic
905799227 1:40832778-40832800 CAGGGTAAACATCTGCCTGGTGG - Intronic
907605822 1:55816470-55816492 CAGAGGTAACTTCAACATGTGGG + Intergenic
909754622 1:79208623-79208645 TCGAGTAAACTTCAACATGGGGG + Intergenic
910217253 1:84854984-84855006 CAGAGTTAACAACAATCTGGTGG + Intronic
910274768 1:85437157-85437179 CTGAGCCAACATGAACATGGAGG + Intronic
912057636 1:105624900-105624922 CAGAGTCTATATCTACATGGAGG + Intergenic
916198343 1:162246333-162246355 CAGAGTGATGAACAACATGGTGG + Intronic
917142064 1:171845176-171845198 AATGGTAAACCTCAACATGGAGG - Intronic
917173654 1:172206649-172206671 CAGTGCAAACGTCAACATAGTGG + Intronic
917955695 1:180095384-180095406 CAGAATAAAAAACAATATGGTGG - Intronic
922898983 1:229121901-229121923 CAGAGGAAACAGCAACATAGAGG + Intergenic
924237021 1:242007609-242007631 CACAGAGAACATCCACATGGAGG - Intergenic
1065454003 10:25887664-25887686 CAGAGTAAAAAAGAACATAGAGG - Intergenic
1067728873 10:48794510-48794532 TAGATTAAATATCATCATGGTGG - Intronic
1070020246 10:72578167-72578189 CTGATTAGCCATCAACATGGAGG + Intronic
1073512005 10:104048399-104048421 CAGAGGAGACAAGAACATGGAGG - Intronic
1076487923 10:130836133-130836155 CAGAGGAAACAGCAACAAAGAGG - Intergenic
1082608069 11:55266342-55266364 CAGAGTATACATCCACAAAGAGG - Intronic
1085004489 11:73072947-73072969 CAGAGTAAACACAGACATGTTGG - Intronic
1092304709 12:7287383-7287405 CAAAGTCAACATGATCATGGTGG - Intergenic
1095245156 12:39911196-39911218 CAGAGTGAACATGAAAATGTTGG + Intronic
1095801222 12:46271244-46271266 CAGAGTAAACATCAACATGGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096887213 12:54730094-54730116 CAGAGTCTACATCAGCTTGGAGG - Intergenic
1097729090 12:63107343-63107365 CAGAGGAAAAATCAAGACGGAGG - Intergenic
1097788331 12:63786618-63786640 CTGATTAGACATCAACATCGAGG - Intronic
1101166638 12:102042839-102042861 CAAAGTAATCATCAAAATGGTGG - Intronic
1106385312 13:29279261-29279283 CAGAAGAAACATCAGCAAGGTGG - Intronic
1109631505 13:65055160-65055182 CTGAGTAAACATCAATATTAAGG + Intergenic
1111592831 13:90371774-90371796 CAGAGAAAACATCATTTTGGTGG - Intergenic
1113162688 13:107400346-107400368 GAGAATAAATATCAACAAGGAGG + Intronic
1116255802 14:42553477-42553499 AAGAGGAAACATGAACATAGAGG - Intergenic
1117227688 14:53679995-53680017 CAGAGTCAACATCTCCAGGGTGG + Intergenic
1120164739 14:81185238-81185260 CAGAGTAAACAGCCACTTTGAGG - Intronic
1120745883 14:88151321-88151343 CAAAGTAAATATCAACAGAGTGG - Intergenic
1122296269 14:100708106-100708128 CATAGGAAACATTGACATGGAGG - Intergenic
1122576501 14:102746463-102746485 CAAAATAAATATTAACATGGCGG + Intergenic
1123829162 15:24116227-24116249 CAGAATAGACATTATCATGGAGG + Intergenic
1123859165 15:24445956-24445978 CAGAATAGACATTATCATGGAGG + Intergenic
1128186873 15:65650068-65650090 AAGAGTAAACCTATACATGGGGG + Intronic
1128212877 15:65914591-65914613 TAGACTAAGCATCAGCATGGAGG - Intronic
1128347429 15:66863384-66863406 CAGAGTAAACATCAAACTCCTGG + Intergenic
1131275574 15:90977888-90977910 AAGAGTAAACATAAATAAGGAGG - Intronic
1131430673 15:92386076-92386098 CAGAAGATACATTAACATGGGGG - Intergenic
1133266598 16:4588339-4588361 TAAAGTGAAAATCAACATGGGGG - Intronic
1135192921 16:20369370-20369392 CAGAATAAAGATCAACTTTGTGG - Intronic
1136598014 16:31265353-31265375 CAGAGAAAACTTCGACATGTGGG - Intronic
1137483596 16:48873153-48873175 CAGAGAAAACATCAGAAAGGAGG + Intergenic
1138574629 16:57899789-57899811 CAAACTAAACAGAAACATGGAGG - Intronic
1139046496 16:63066343-63066365 AAAAGTAAACATCAATAGGGAGG - Intergenic
1139192463 16:64880319-64880341 CAGATCAAACATCAACCTGGTGG + Intergenic
1139235604 16:65335360-65335382 AATAGTAAACCTCATCATGGGGG + Intergenic
1140936686 16:79677345-79677367 GAGAATAAACATCAACTTAGGGG - Intergenic
1142050388 16:87954426-87954448 AACAGTAAACATCAGTATGGAGG - Intronic
1144370696 17:14588773-14588795 CAGATTAAACATCTAGATGATGG - Intergenic
1149237646 17:54611737-54611759 GAGAGTAAGCATCCACATGGGGG + Intergenic
1155399394 18:25421198-25421220 CAGAGGAAACATGAACATTTTGG + Intergenic
1155859622 18:30880809-30880831 CAAAGTAAATTTCACCATGGAGG + Intergenic
1155873116 18:31051706-31051728 CAGATAAAACATCAACATCCAGG - Intergenic
1156095432 18:33525798-33525820 CACAATAAATATCAAAATGGGGG - Intergenic
1159777002 18:72614031-72614053 CAGAGAAAACATGATCTTGGAGG - Intronic
925039458 2:719901-719923 CAAAGTCAGCATCAGCATGGAGG - Intergenic
928773365 2:34729220-34729242 CAGAATAAAAATCACCATTGAGG + Intergenic
929266585 2:39925548-39925570 CAGAGCAGACCTCAACCTGGTGG + Intergenic
934071128 2:88384719-88384741 AATAGAAATCATCAACATGGAGG - Intergenic
935868313 2:107416474-107416496 CAGGGTGAAAAACAACATGGGGG - Intergenic
936052350 2:109234002-109234024 CACAGTAAACATTGACATGAAGG + Intronic
938815039 2:134893598-134893620 CATAGGAATCATCAACATGGTGG - Intronic
938843659 2:135186393-135186415 AAGACTAACCATCAACATGTGGG - Intronic
939282771 2:140086280-140086302 CAAATTAAACATCAAAATGCAGG - Intergenic
939462161 2:142511234-142511256 CAGACTAAACATCGACTTTGTGG + Intergenic
939967814 2:148627788-148627810 CAGAGTATGCAGCAACATAGTGG - Intergenic
941302443 2:163819944-163819966 AAGAGTAAATGTCAACATAGAGG + Intergenic
942710008 2:178823168-178823190 CAGAGAAAAAATAATCATGGTGG - Intronic
944299019 2:198101256-198101278 CAAAATAAACATCAAAAAGGTGG - Intronic
946195364 2:218029379-218029401 CAGAGACATCATCAAAATGGAGG + Intergenic
1169780389 20:9303044-9303066 TAGATTAAAAAACAACATGGTGG - Intronic
1172950435 20:38720014-38720036 CAGAGCAGACAGCACCATGGGGG - Intergenic
951084636 3:18497110-18497132 CAGAGTACTCTTCAACCTGGGGG - Intergenic
951555143 3:23913920-23913942 CAGAGAATACATCAACACTGAGG + Intronic
955644726 3:61124928-61124950 CTGATGAAACATCAGCATGGAGG - Intronic
956398876 3:68855000-68855022 CAGAGTAAAAATCATAATAGGGG + Intronic
957115546 3:76019793-76019815 CAGAGAAAACCTAAACATGTGGG - Intronic
957380220 3:79418088-79418110 TAGAATGAACATCAGCATGGTGG + Intronic
959116060 3:102179697-102179719 CAGAGTAAACATGAACAAACTGG - Intronic
964229381 3:154445833-154445855 CAGATTAAAAATCAGCATAGTGG - Intergenic
972526831 4:39922022-39922044 GAGAGCAAATATCAACATTGGGG + Intronic
973116777 4:46470776-46470798 CAGAGACATCATCAGCATGGCGG - Intronic
975018940 4:69463263-69463285 CAGAGTAAACATAAATATATTGG + Intergenic
975382106 4:73712548-73712570 CAGAGAAACCAGCAACAGGGTGG + Intergenic
976841366 4:89436467-89436489 CAGAATAAACAGCACTATGGAGG - Intergenic
977126613 4:93176802-93176824 CAGAGATAACATAAACATAGAGG - Intronic
978223152 4:106302247-106302269 CAGAGTAAACAGCAATATAGTGG + Intronic
979007583 4:115321497-115321519 TTGAGTAAACATGAACTTGGGGG + Intergenic
980255786 4:130379458-130379480 CAGAGGAAACATCAGGGTGGGGG + Intergenic
982155132 4:152512285-152512307 CACAGTAAACAACAACAAGATGG + Intronic
982562523 4:156947454-156947476 CTAAGTAAACATCAAAATGAAGG + Intronic
985092505 4:186378528-186378550 CAGAGAAAAGAACATCATGGTGG - Intergenic
988373544 5:30404370-30404392 CAGAGTAAAAAAGAACATGATGG - Intergenic
988977234 5:36527323-36527345 CAGAGTACACAGTAACAGGGGGG - Intergenic
988993230 5:36691255-36691277 CAGAGAAAAATTCAAAATGGGGG - Intergenic
989398105 5:40980161-40980183 CAGAGTAAAAATCATGAAGGTGG - Intronic
989817356 5:45752057-45752079 CTCAGGAAACATCATCATGGTGG + Intergenic
991180148 5:63741360-63741382 CAGAGAAAACATCCATATGATGG + Intergenic
991258256 5:64638885-64638907 CAGAGTAAAAATAAACATCATGG - Intergenic
993227462 5:85185050-85185072 CTGAGTAAACACAAACTTGGGGG - Intergenic
994081694 5:95714373-95714395 CCGAAGAAACATCAACATGTAGG + Intronic
996775281 5:127126190-127126212 AATAGGAAACATCAACATAGTGG - Intergenic
996905164 5:128591030-128591052 TAGAGTATACATGTACATGGAGG - Intronic
997520442 5:134520523-134520545 CATTGGAATCATCAACATGGAGG - Intergenic
999563048 5:152825982-152826004 CAGAGAAAGCCTCAACAAGGAGG - Intergenic
1000504458 5:162097715-162097737 CCGATTGAACAGCAACATGGTGG + Exonic
1001616092 5:173044846-173044868 CAGGCTAAAAATCAAAATGGAGG - Intergenic
1001891611 5:175344096-175344118 CAGTGTACACAGCCACATGGGGG + Intergenic
1001962826 5:175890528-175890550 CAGAGTAATCACCTCCATGGCGG + Intergenic
1002810098 6:620421-620443 CAAAGTAAACCCCAAGATGGTGG - Intronic
1003631646 6:7792771-7792793 TAGAGTAAACTTCCACATGTTGG - Intronic
1003931566 6:10928885-10928907 AAGAGTATACACAAACATGGAGG - Intronic
1007964412 6:45990387-45990409 AAGAGTAAAAGTCAAGATGGAGG - Intronic
1008225943 6:48916876-48916898 AAGAGCAAACATCTACTTGGAGG + Intergenic
1009346386 6:62616964-62616986 CAAGGTAAACATAAATATGGAGG - Intergenic
1011572858 6:88758678-88758700 CAGAGTTAACATCAGCAGTGAGG - Intronic
1015258580 6:131208758-131208780 CAGAGGATCCATTAACATGGGGG - Intronic
1017363006 6:153598630-153598652 CAGAGTAACCATCAGCAAGAAGG - Intergenic
1017765356 6:157602751-157602773 CAGAGGAAGCATCCTCATGGCGG - Intronic
1019500400 7:1361737-1361759 CAGTGGAACAATCAACATGGAGG + Intergenic
1021470981 7:21002375-21002397 CAGAGGAAGCTTCAAAATGGCGG + Intergenic
1021952078 7:25785176-25785198 CAGTGGCAACATCAAGATGGTGG - Intergenic
1028615494 7:92762140-92762162 CAGAGTAATAATCATAATGGGGG + Intronic
1029910445 7:104140640-104140662 CAGAGTGAAAATGACCATGGTGG + Intronic
1032935359 7:136723878-136723900 CAGAGAAAACATCAATACAGAGG + Intergenic
1034142955 7:148839510-148839532 CAGAAATAACATCAAAATGGGGG + Intronic
1034284496 7:149875595-149875617 CAGAGTGATCATCACCATGCTGG + Exonic
1037151696 8:15643176-15643198 CTCAGTAAACATGATCATGGCGG - Intronic
1037204488 8:16298494-16298516 AAGAGTATATACCAACATGGCGG - Intronic
1039939451 8:42076906-42076928 CAGAGTAAAAATCAACACAAAGG - Intergenic
1040361594 8:46670054-46670076 CAGGGTAAATATCAACAGAGTGG + Intergenic
1040483740 8:47851115-47851137 CAGAGTAAACATAAAGAAGTTGG - Intronic
1041203309 8:55472562-55472584 CAGAGGAACCAGCAACAAGGGGG + Intronic
1044396177 8:91715716-91715738 GAGAGTAAAGATCAAGTTGGCGG - Intergenic
1053459467 9:38257460-38257482 CAGAGTAAAAATAAACTTGAAGG - Intergenic
1056663324 9:88560451-88560473 CAAAGCAAAGATCCACATGGTGG + Intronic
1058327897 9:103721043-103721065 CAGTGTAGAAATGAACATGGGGG + Intergenic
1059702736 9:116791513-116791535 CAGTGTAAACAAGATCATGGGGG + Intronic
1062423335 9:136494571-136494593 CACAGTAAAAATCAACATCTTGG + Exonic
1186213072 X:7270606-7270628 CAGAGTATACATAAAGATGCTGG + Intronic
1187078080 X:15956302-15956324 TAGTCTAGACATCAACATGGAGG + Intergenic
1187790643 X:22946351-22946373 CAGAGTAACCTTACACATGGTGG - Intergenic
1190010891 X:46783752-46783774 GAGAGTGGACATCAGCATGGGGG + Intergenic
1191207824 X:57853132-57853154 CACTGCAAACATCCACATGGTGG - Intergenic
1192776511 X:74251185-74251207 CAGCGCAAACATGAACATGTTGG + Intergenic
1197581767 X:128293227-128293249 CTGAGGAAACATAATCATGGTGG - Intergenic
1199184388 X:144898137-144898159 CAAAGTGAGCATCAGCATGGTGG + Intergenic
1202051425 Y:20784723-20784745 CAGTGCAAACATTAGCATGGTGG + Intergenic