ID: 1095802440

View in Genome Browser
Species Human (GRCh38)
Location 12:46282300-46282322
Sequence GTTTATGTACCAGCAATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095802440_1095802441 -9 Left 1095802440 12:46282300-46282322 CCTGTCATTGCTGGTACATAAAC No data
Right 1095802441 12:46282314-46282336 TACATAAACAAGCAACCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095802440 Original CRISPR GTTTATGTACCAGCAATGAC AGG (reversed) Intergenic
No off target data available for this crispr