ID: 1095809603

View in Genome Browser
Species Human (GRCh38)
Location 12:46357794-46357816
Sequence ATCTGGTTTTTTACTTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 344}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095809603_1095809607 -2 Left 1095809603 12:46357794-46357816 CCTTCTTAAGTAAAAAACCAGAT 0: 1
1: 0
2: 0
3: 29
4: 344
Right 1095809607 12:46357815-46357837 ATCCTGGGCTACCCTACAGCTGG 0: 1
1: 0
2: 1
3: 9
4: 85
1095809603_1095809612 22 Left 1095809603 12:46357794-46357816 CCTTCTTAAGTAAAAAACCAGAT 0: 1
1: 0
2: 0
3: 29
4: 344
Right 1095809612 12:46357839-46357861 CCTTTGCAATCAGACAAACTAGG 0: 1
1: 0
2: 3
3: 52
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095809603 Original CRISPR ATCTGGTTTTTTACTTAAGA AGG (reversed) Intergenic
903611588 1:24618705-24618727 ATCTGTTTTTTTTTTTAAGACGG - Intergenic
905437103 1:37964171-37964193 TTCTTGTTTTTTATTTGAGACGG - Intronic
905642703 1:39602382-39602404 TTTTTATTTTTTACTTAAGATGG + Intergenic
907015611 1:51009790-51009812 ATCTGGTGGATTTCTTAAGAAGG - Intergenic
907134191 1:52123891-52123913 ATTTGTTTTTTTTTTTAAGATGG + Intergenic
907185684 1:52607408-52607430 ATCTGGTATTTTAGCTTAGAAGG - Intronic
907386161 1:54126799-54126821 GTCTCGTTTTTTGCTTAAGCTGG + Intergenic
908438195 1:64127783-64127805 ATTTGGTTTTCAAGTTAAGATGG - Intronic
908565495 1:65351767-65351789 ATATTTTTTTTTTCTTAAGATGG + Intronic
909379187 1:74977881-74977903 TTTTGTTTTTTTTCTTAAGACGG - Intergenic
910831849 1:91469340-91469362 ATTTCTTTATTTACTTAAGATGG - Intergenic
911500155 1:98675848-98675870 ATTTGATTTTTTTCTTAACAAGG - Intronic
912215510 1:107606864-107606886 TTGTTGTTTGTTACTTAAGAAGG + Intronic
912317786 1:108681928-108681950 ATTTGATTTTTTAGATAAGATGG - Intergenic
912667339 1:111594139-111594161 ATCTGGTTTTATACTTATGCGGG - Intronic
913071395 1:115302226-115302248 ATGTAGTGTTTTATTTAAGAAGG + Intronic
917200207 1:172506836-172506858 ATCTGGTTATTTAGGTCAGAAGG + Intergenic
919142806 1:193594261-193594283 AACTGTTTTTTTAATTAAAAAGG - Intergenic
919502691 1:198357049-198357071 ATATTGTCTTTAACTTAAGAAGG - Intergenic
919621863 1:199872256-199872278 ATCTTTTTTTTTTTTTAAGATGG - Intergenic
919811020 1:201408871-201408893 AACTGGGTTTTTAATGAAGAAGG + Exonic
922027650 1:221766301-221766323 TTTTGGTTTTTTATTTCAGATGG + Intergenic
922300113 1:224291706-224291728 ATGATGTTTTTGACTTAAGATGG - Intronic
922415707 1:225420933-225420955 ATCTGATTATTTCCTTAGGATGG - Intronic
922934427 1:229412309-229412331 ATTTGGTTGTTTGCTTGAGATGG + Intergenic
923018657 1:230146396-230146418 TTCTGGTTATTTCCTTAATATGG + Intronic
923389483 1:233499853-233499875 TTCTGCTTTTTAACATAAGAAGG + Intergenic
923646075 1:235821633-235821655 ATCTGGTTCTTTATATAAAAAGG - Intronic
923790769 1:237109340-237109362 AGCTGGTTTTTTTTTTAAGTTGG + Intronic
1065003067 10:21354761-21354783 ATCTGTTTCTTTTCTTGAGATGG - Intergenic
1065695723 10:28377940-28377962 ATCAGTTTTTTTATTTAACATGG - Intergenic
1066361366 10:34734819-34734841 ATCTAGTGTCTTGCTTAAGAAGG - Intronic
1066804068 10:39225740-39225762 TTCTAGTTTTTAACTGAAGATGG - Intergenic
1067862757 10:49870051-49870073 ATCTAGTTGTTTAATTAACAAGG - Intronic
1068353616 10:55881800-55881822 ATTTTGTTTTTTTCTTAAAATGG - Intergenic
1068570933 10:58628207-58628229 ATCTGTTTTTCTTCATAAGATGG - Intronic
1069402435 10:68063378-68063400 TTCTGGTTTTTTAGTAGAGACGG + Intronic
1070375248 10:75824477-75824499 ATCTGGACTTTTACAAAAGAAGG + Intronic
1070681955 10:78454903-78454925 ATTTGGCTGTGTACTTAAGAGGG + Intergenic
1070953963 10:80452869-80452891 ATTTGTTTGTTTAATTAAGAGGG - Intergenic
1071034303 10:81224498-81224520 AACTTGTTTCTTACTTAATATGG - Intergenic
1071560436 10:86642696-86642718 ATCTGGTATTCTGCTTAACAGGG + Intergenic
1072208336 10:93224115-93224137 ATCTAGGTTTTTACTTTAGGGGG + Intergenic
1072369189 10:94746271-94746293 AGCTAGTTTGTTTCTTAAGATGG + Intronic
1074927908 10:118092565-118092587 ATCTGCTTGTATACTTAGGAAGG + Intergenic
1080999330 11:37648518-37648540 TTCTGTTTTTTTTCTAAAGAAGG + Intergenic
1081554449 11:44145056-44145078 ATCTAGTTTTTTTCTGAAGATGG - Intronic
1082224902 11:49693563-49693585 GCCTGGTTTTTGACTTTAGAAGG + Intergenic
1083465163 11:62840753-62840775 TTTTGGTTTTTTAGTGAAGACGG + Intronic
1084655531 11:70514473-70514495 ATCTGCTTTTAAAATTAAGAGGG - Intronic
1086172262 11:83850156-83850178 GTGTGTTTTTTTACTTGAGACGG + Intronic
1086338011 11:85818695-85818717 ATCTATTTATTTATTTAAGACGG + Intergenic
1086721820 11:90130018-90130040 ATCTGATTTTTGACTTAGGAAGG + Intergenic
1086977655 11:93154753-93154775 GTCTGCTTTTAGACTTAAGATGG - Intronic
1087284569 11:96251200-96251222 ATGTTGTCTTTTACTAAAGATGG + Intronic
1088275573 11:108081745-108081767 AACTGATTTTTTTCTTGAGACGG - Intronic
1089052310 11:115556574-115556596 ATATAGTTTTTTAATTGAGACGG - Intergenic
1089211735 11:116808648-116808670 ACCTGGCTTTTTACTTAGGACGG - Intergenic
1092014961 12:5151009-5151031 ATATTGCTTTTTACTTAAGTGGG + Intergenic
1092134316 12:6135770-6135792 ATCTTTTTTTTTTTTTAAGACGG - Intergenic
1092266377 12:6983970-6983992 ATCTTGTTTTTTAATAGAGACGG - Intronic
1092443573 12:8531438-8531460 GTTTTGTTTTTTACTTCAGAGGG + Intergenic
1093083574 12:14841699-14841721 ATCTGTTTTCTTACTGAAAAAGG + Intronic
1093093085 12:14942870-14942892 ATCTTTTTTTTTTTTTAAGATGG + Intronic
1093537867 12:20244371-20244393 AACAAATTTTTTACTTAAGAAGG - Intergenic
1095809603 12:46357794-46357816 ATCTGGTTTTTTACTTAAGAAGG - Intergenic
1096721890 12:53529201-53529223 ATTTAGTTATTTATTTAAGACGG + Intronic
1102513841 12:113433773-113433795 ATCTGGTGTTTGACTTTAGGGGG + Intronic
1103707392 12:122884659-122884681 AGCTGGTTTTTTTTTTGAGATGG - Intronic
1103829989 12:123771296-123771318 CTGAGGTTTTTTACTTAAAAGGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104295696 12:127510614-127510636 ATTTGGTGTATTATTTAAGACGG + Intergenic
1105627055 13:22122703-22122725 ATGTGCTTTTTGATTTAAGAAGG - Intergenic
1108875548 13:55044452-55044474 ATCTTTTTTTTTTTTTAAGATGG - Intergenic
1111827347 13:93284150-93284172 ATCTGATTTTATATTTAAAAGGG + Intronic
1111923355 13:94435932-94435954 ATCTGTTGTTTTAATAAAGAAGG + Intergenic
1113362054 13:109640597-109640619 ATCTGATTTTTATTTTAAGAAGG - Intergenic
1113676579 13:112211446-112211468 ATTTGGTTTTTGATTTAAGGAGG + Intergenic
1114151367 14:20043460-20043482 AAATGGTTTTTTAATTGAGAAGG - Intergenic
1115539590 14:34407524-34407546 ATCTGGATTTTTTCTTTAGCAGG - Intronic
1116850353 14:49902841-49902863 ATCTGTTTTTTTTTTTGAGATGG + Intergenic
1118059400 14:62118293-62118315 TGCTGGTTTGTTACTTTAGAGGG + Intergenic
1118115705 14:62774218-62774240 TTCTGGTTTTGTACTGGAGATGG + Intronic
1118199107 14:63655761-63655783 TTTTGTTTTTTTCCTTAAGACGG - Intergenic
1118422404 14:65621563-65621585 CTCTTTTTTTTTATTTAAGATGG + Intronic
1118514417 14:66509306-66509328 ATCCAGCTTTTTACTTGAGAGGG + Intronic
1119095108 14:71822856-71822878 ATCTGGTTTTTATTTTAAGAAGG - Intergenic
1119177409 14:72579329-72579351 AGATGGTCTTTTACTAAAGATGG - Intergenic
1119505008 14:75164992-75165014 ATGTGGTTTTTAACTTAATAAGG + Intronic
1119848528 14:77848468-77848490 ATTTATTTATTTACTTAAGATGG + Intronic
1119990889 14:79196016-79196038 ATCTGGTATTTTTCTTAAGTGGG - Intronic
1120354999 14:83421259-83421281 ATCTCCTTTTTTAATTGAGAAGG - Intergenic
1120492206 14:85191958-85191980 ATCATTTTTTTTTCTTAAGATGG - Intergenic
1120978553 14:90271199-90271221 ATCAGGTTATTTACTTCAAATGG - Exonic
1121187155 14:91984094-91984116 AACTGATTTTTTTTTTAAGAAGG - Intronic
1121200502 14:92113088-92113110 ATTTGTTTGTTTATTTAAGATGG + Intergenic
1121545957 14:94763826-94763848 CTCCTGTTTTTTACTTAAGGAGG + Intergenic
1121614863 14:95306878-95306900 CTCTGGTTTCTTACTGTAGAAGG - Intronic
1121986282 14:98509520-98509542 ATCTGGTGTTTTAATTAACAAGG + Intergenic
1122701506 14:103592472-103592494 ATCTTTTTTTTTTCTTGAGATGG - Intronic
1123768876 15:23509348-23509370 ATCTGGTTTTTTATCTATCATGG + Intergenic
1124691617 15:31827928-31827950 ATGTGGTTTTTTTTTTGAGATGG - Intronic
1126765047 15:52003181-52003203 TTTTGGTTTTTTTTTTAAGACGG - Intronic
1128445279 15:67754208-67754230 AACTGGTTTGTTACTTTAAAAGG + Intronic
1128993020 15:72276241-72276263 AACTGCTTTTCTACTTAAGTAGG - Intronic
1129049525 15:72768659-72768681 ATTTTTTTTTTTTCTTAAGATGG - Intronic
1130278373 15:82496386-82496408 ATCAGGTCTGTTACTGAAGATGG + Intergenic
1130435272 15:83892209-83892231 ATTTAGTTTTTTTTTTAAGATGG - Intronic
1130470701 15:84223570-84223592 ATCAGGTCTGTTACTGAAGATGG + Intergenic
1130478190 15:84338138-84338160 ATCAGGTCTGTTACTGAAGATGG + Intergenic
1130493575 15:84449992-84450014 ATCAGGTCTGTTACTGAAGATGG - Intergenic
1130592989 15:85228197-85228219 ATCAGGTCTGTTACTGAAGATGG + Intergenic
1131004224 15:88963329-88963351 ATCTGGTTTTATTCTTCATATGG + Intergenic
1131817723 15:96238881-96238903 AAATGGATTTTTTCTTAAGATGG - Intergenic
1133801503 16:9089706-9089728 ATCTTTTTTTTTCCTTAAGAAGG + Intergenic
1135240498 16:20803005-20803027 AACTGGTTGTTTAATTAAAATGG - Intronic
1135710807 16:24715620-24715642 TTCTTTTTTTTTAATTAAGACGG + Intergenic
1137278354 16:46952911-46952933 ATTTTGTTTTTTTCTTGAGACGG - Intergenic
1137781395 16:51100620-51100642 AGATGGTTTTTTTTTTAAGATGG - Intergenic
1138978672 16:62240215-62240237 ATCTGATATTTTTATTAAGAAGG - Intergenic
1139723995 16:68881095-68881117 ATCAGTTTTTTCACTTAAAAAGG - Intronic
1139780526 16:69347728-69347750 AACTGATTTTTAACTTCAGAGGG - Intronic
1139784206 16:69378153-69378175 ATATGGTTTTTCTCTTAATATGG + Intronic
1139920511 16:70457013-70457035 ATCTATTTTTTTTTTTAAGATGG - Intronic
1139976005 16:70810825-70810847 CTCTGGTTTTTTTTTTGAGACGG - Intronic
1141143649 16:81514196-81514218 ATCTGGTTTTGTGGTGAAGAGGG + Intronic
1141740765 16:85891099-85891121 ATCTGTTTCTTTACTCTAGAAGG - Intergenic
1143816683 17:9522100-9522122 GTTTTGTTTTTTGCTTAAGATGG - Intronic
1144114218 17:12070798-12070820 ATCTGGTTCTTTACAGAAAAAGG + Intronic
1144169341 17:12644487-12644509 TTCTGGTTTTTTACTGTTGATGG + Intergenic
1144514324 17:15905658-15905680 AGCTGGTTTCTTTTTTAAGAGGG + Intergenic
1148182594 17:45617583-45617605 AGCTGGTTTTTTTTTTAAAAGGG - Intergenic
1148731790 17:49841365-49841387 TTCTGGTTGTTTCCTTAAGAGGG - Intronic
1149465310 17:56873835-56873857 ATCTGTTTTTTTTTTTGAGATGG - Intergenic
1149800228 17:59560751-59560773 TTCTGGTTTTTTAATGGAGAAGG + Intergenic
1149813899 17:59704791-59704813 TTCTTTTTTTTTTCTTAAGACGG + Intronic
1150492251 17:65582578-65582600 TTCTGGTTTTTTTTTTGAGATGG + Intronic
1150663797 17:67110819-67110841 ATCTGGCTTTTTACAGAAGAAGG + Intronic
1151774151 17:76187186-76187208 TTCTTTTTTTTTTCTTAAGATGG + Intronic
1153321122 18:3775166-3775188 ATCTTTCTTTTTCCTTAAGAAGG + Intronic
1153367361 18:4272629-4272651 CTCTGGCTTTTTACTTCATATGG - Intronic
1153668891 18:7391779-7391801 ATCTAATTTTTTTTTTAAGATGG + Intergenic
1153706422 18:7750044-7750066 ATCTGGTATTCTACTTGATAAGG + Intronic
1153846269 18:9052214-9052236 ATCTGATTTTTTTTTTGAGATGG + Intergenic
1153861430 18:9213103-9213125 GTTTGGTATTTTATTTAAGAAGG + Intronic
1154265653 18:12876459-12876481 ATCTTCTTTTTTTCTTGAGAAGG - Intronic
1154972310 18:21422933-21422955 ATCTGTGTTTTTTCTTTAGACGG + Intronic
1155129389 18:22916312-22916334 ATGTCATTTTTTACCTAAGAGGG + Intronic
1155269313 18:24123962-24123984 ATCTGGTGTATTACTTATGATGG + Intronic
1155766572 18:29641853-29641875 ATTTTATTTTTTATTTAAGATGG - Intergenic
1156956242 18:42967722-42967744 ATTTGGATTTTTGCTAAAGAAGG - Intronic
1157111351 18:44823348-44823370 ATTTGGTATTTTCCTTCAGATGG - Intronic
1157744318 18:50121385-50121407 ACTTGGAATTTTACTTAAGAAGG - Intronic
1157783825 18:50464435-50464457 ATCTTTTTTTTTTTTTAAGAGGG - Intergenic
1157872441 18:51242967-51242989 ATTTGGTTTTTTAAAAAAGAAGG + Intergenic
1158293202 18:55965151-55965173 ATGTGGTTGCTCACTTAAGAAGG + Intergenic
1158916790 18:62140309-62140331 ATCTGGGTTTTTTTTTTAGATGG - Intronic
1162374618 19:10297294-10297316 GCCTGGTTTTTTTTTTAAGACGG - Intergenic
1163416600 19:17190661-17190683 TTCTTTTTTTTTTCTTAAGACGG + Intronic
1164090681 19:21949029-21949051 ATCTGGTTTCTGATTTAACAGGG - Intronic
1164109825 19:22145717-22145739 ATCTGGTTTCTGATTTAACAAGG - Intergenic
1164175897 19:22774161-22774183 AACTGAGTTTTTACCTAAGATGG - Intronic
1164194797 19:22946847-22946869 ATCTGGTTTCTGATTTAACAGGG - Intergenic
1164239620 19:23373072-23373094 ATCTGGGTTTGTAGTGAAGAAGG - Intronic
1164813791 19:31178673-31178695 ATCTTCTTTTTTTCTTGAGAAGG - Intergenic
1165441794 19:35832581-35832603 ATTTTGTTTTTTAATTAAGACGG + Intronic
1165666993 19:37639857-37639879 ATCTGGCTTGTCACTTAAGTAGG - Intronic
1166094757 19:40531615-40531637 GTCTGGTTTTTTACTGGAGGGGG + Intronic
1166526846 19:43516271-43516293 ATGTGGTCCTTGACTTAAGATGG + Intronic
1167141824 19:47656864-47656886 GTTTGGTTTTTTTTTTAAGATGG + Intronic
1167887111 19:52509320-52509342 TTGTGGCTTTTTTCTTAAGAGGG + Intronic
1167893671 19:52563189-52563211 TTGTGGCTTTTTTCTTAAGAGGG + Intronic
1167911609 19:52708096-52708118 TTGTGGCTTTTTTCTTAAGAGGG - Intronic
1167914524 19:52729767-52729789 TTGTGGCTTTTTTCTTAAGAGGG - Intronic
1167919365 19:52770020-52770042 TTGTGGCTTTTTTCTTAAGAGGG - Intronic
1167923426 19:52803546-52803568 TTTTGGCTTTTTTCTTAAGAGGG - Intronic
1167928466 19:52843701-52843723 TTTTGGCTTTTTTCTTAAGAGGG - Intronic
1167936072 19:52909742-52909764 TTGTGGTTTTTTTCTTAAGAGGG - Intergenic
1168138659 19:54369457-54369479 TTCTGGGTTTTTCCATAAGAAGG + Intronic
1168582266 19:57565451-57565473 ATCTGATTTTTGATTTAACATGG + Intergenic
926431815 2:12794834-12794856 ATCTTTTTTTTTTCTTGAGATGG + Intergenic
926532764 2:14071302-14071324 TACTGGTTTTTTACTTCAGTTGG + Intergenic
927325975 2:21805653-21805675 ATCTAGTTTTATACTCAAGCAGG + Intergenic
927435821 2:23065245-23065267 TTCTGGTTTTTTTTTTGAGATGG - Intergenic
929811779 2:45194923-45194945 TTCTGATTTTTGTCTTAAGAAGG + Intergenic
931486919 2:62703336-62703358 ATCTTTTTTTTTTCTTGAGACGG - Intronic
932172904 2:69573660-69573682 TTCAGGTTATTTCCTTAAGATGG - Intronic
935184494 2:100719525-100719547 TTCTGGTCATTTCCTTAAGAAGG + Intergenic
935290607 2:101607843-101607865 TTTTGGTTTTTTATTTGAGATGG + Intergenic
935519969 2:104092598-104092620 AAATAGTTTTTTACTTATGAAGG - Intergenic
935877134 2:107521666-107521688 TTTTGGTTTCTTACTTAAGAGGG + Intergenic
937289828 2:120775650-120775672 ATCAGGTTTTTTAACTAGGAAGG - Intronic
937943885 2:127313337-127313359 ATCAGGTTTCGTACTTAACAAGG + Intronic
938057841 2:128230479-128230501 ATTTTGTTTTTTTTTTAAGACGG + Intergenic
938658820 2:133464683-133464705 ATTTGTTTATTTATTTAAGATGG - Intronic
939433185 2:142137585-142137607 TTTTTGTTTTTTACTTTAGAGGG + Intergenic
941030972 2:160511290-160511312 TTCTTTTTTTTTCCTTAAGACGG + Intergenic
941143248 2:161811662-161811684 ATCTTGCTTTGTACTTCAGAGGG + Intronic
945359937 2:208885114-208885136 ATTTTGTTTTTTTCTCAAGACGG + Intergenic
946041619 2:216787715-216787737 ATCTGGTCTTTTACATAAAATGG + Intergenic
946636596 2:221735134-221735156 TTTTGTTTTTTTAGTTAAGACGG + Intergenic
1169919635 20:10721009-10721031 ACCTGCTTTTTTCCTTAATATGG - Intergenic
1170066398 20:12315240-12315262 TTGTAATTTTTTACTTAAGATGG + Intergenic
1170433941 20:16304539-16304561 ATCTGGTTATTTACATTAGCAGG - Intronic
1173588321 20:44202374-44202396 TTCTTTTTTTTTTCTTAAGATGG - Intronic
1174120719 20:48263288-48263310 GTCTGGTTTTTTCCTTTGGAGGG - Intergenic
1174610890 20:51798069-51798091 AACTGGTTAAATACTTAAGAAGG - Intronic
1175280083 20:57798066-57798088 GTCTCATTTTTTGCTTAAGATGG + Intergenic
1176876487 21:14135331-14135353 ATCTGATTTTTTGGTTATGAAGG - Intronic
1177265699 21:18780432-18780454 ATCTAGTATTGTACTTAAGGTGG + Intergenic
1178042305 21:28652729-28652751 ATCTGGTTTATGTCTTAAGAAGG - Intergenic
1178272715 21:31207568-31207590 ATCTGATTTTATTCTTAAGAGGG - Intronic
1180609537 22:17086127-17086149 TTTTGTTTTTTTCCTTAAGATGG - Intronic
1181189813 22:21130035-21130057 ATCTGTATTTTTACTAGAGACGG - Intergenic
1181209391 22:21280470-21280492 ATCTGTATTTTTACTAGAGACGG + Intergenic
1183900903 22:41005269-41005291 ATCTCTTTTTTTTTTTAAGATGG + Intergenic
1184097068 22:42321940-42321962 ATCTTTTTTTTTTTTTAAGATGG - Intronic
1184314808 22:43677654-43677676 TTCTTGTTTTTTTCTTGAGATGG - Intronic
949263512 3:2130480-2130502 TTCTGGCTTTTTAATTTAGAGGG - Intronic
949467477 3:4358794-4358816 ATCAGATTTTTTACTTTTGATGG + Intronic
951266691 3:20576414-20576436 ATCTGGTTTTTATCCCAAGAAGG - Intergenic
951995231 3:28720216-28720238 ATTTGGCTTTTTATTTCAGAGGG - Intergenic
952126982 3:30312409-30312431 ACCTCGCTTTTAACTTAAGATGG + Intergenic
952216969 3:31287662-31287684 ACCTGTTTTTTTCCTTAATAAGG + Intergenic
952926520 3:38324330-38324352 ATATTGTTTTTTCTTTAAGACGG + Intergenic
953591803 3:44264201-44264223 TGCTGGTTTTCTAGTTAAGAAGG + Intronic
954345462 3:49993936-49993958 ATCTTTTTTTTTATTTGAGATGG - Intronic
954550633 3:51478657-51478679 TTTTGTTTTTTTAATTAAGACGG + Intronic
954567679 3:51612292-51612314 TTCTGTTTTTTTAGTAAAGATGG - Intronic
956540464 3:70332598-70332620 ATTTGGTTTTTTTTTTGAGATGG + Intergenic
956634206 3:71347178-71347200 ATTTGGTTCTTTCTTTAAGAAGG + Intronic
956821679 3:72959637-72959659 ATCTTTTTTTTTTCTTGAGATGG + Intronic
957400893 3:79712155-79712177 TTCTGGCTTTTTAATTAAAATGG - Intronic
959281881 3:104352784-104352806 ATATTGTTTTTTCCTTAACATGG + Intergenic
959740200 3:109710093-109710115 AGCTTGTTTTTTAATGAAGAAGG - Intergenic
961575197 3:127830354-127830376 ATCTGGCTTTTTATTTCAGTAGG + Intergenic
961942094 3:130648678-130648700 ATTTCTTTTTTTACTTAATAAGG - Intronic
963635077 3:147784652-147784674 ATTTATTTATTTACTTAAGATGG + Intergenic
964069704 3:152616584-152616606 ATCTGGTTTTTTTTTTGAGACGG - Intergenic
965682109 3:171262225-171262247 ATCTGGTTGTTTTATTAAAAAGG - Intronic
966117835 3:176486203-176486225 ATCCTGTTTTTTTTTTAAGAAGG - Intergenic
966284464 3:178277566-178277588 ATCTGGTGTTTTACAGAAAAAGG - Intergenic
966706517 3:182922232-182922254 ATCTGTTTTTATATTTAAAAAGG + Intergenic
967073906 3:185984935-185984957 TTGTGTTTATTTACTTAAGATGG - Intergenic
970341093 4:15107736-15107758 TTTTGGTTTTTTAAATAAGATGG - Intergenic
971544218 4:27864360-27864382 ATCTGTTTTTTTATTTGACACGG - Intergenic
972137953 4:35916186-35916208 ATATGATTTTTTTCTAAAGAGGG + Intergenic
972243143 4:37215903-37215925 ATTTGGCAGTTTACTTAAGATGG - Intergenic
974006923 4:56567269-56567291 ATATTTTTTTTTAATTAAGATGG + Intronic
974473215 4:62345705-62345727 TTCTAGTTGTTTACTTCAGAAGG + Intergenic
975506336 4:75142807-75142829 ATCTGGTTTTTTATTCCAGTTGG - Intergenic
976299377 4:83503596-83503618 TTCAGGTTTTTTTCTTAAGATGG + Intronic
976528067 4:86116469-86116491 ATCTGGTTTTATATGTGAGATGG + Intronic
977357037 4:95959451-95959473 ATCTGATTATTTAAATAAGATGG + Intergenic
977704656 4:100057823-100057845 CTCTGTTTTTTTACTTACGAGGG - Intergenic
978169564 4:105652930-105652952 ATCTGTTTTTAAATTTAAGAGGG - Intronic
978215176 4:106192177-106192199 ATCTGTTTTTATACTTTATAGGG - Intronic
978697807 4:111603847-111603869 ATCTTTTTTTTTTCTTGAGACGG + Intergenic
979539719 4:121868043-121868065 ATCTGGTGTTTTTCTTTAGGTGG - Exonic
980506707 4:133733624-133733646 ATTTGATCATTTACTTAAGAAGG + Intergenic
982420603 4:155192251-155192273 CTGTGGTTTTATATTTAAGAAGG + Intergenic
982624859 4:157753591-157753613 ATCTTTTTTTTTTTTTAAGATGG - Intergenic
984259895 4:177432408-177432430 ATAAGGTTTATTTCTTAAGAGGG + Intronic
984388692 4:179099260-179099282 ATCTTGTTTTTCATTTAAGTTGG - Intergenic
984502333 4:180571839-180571861 ATGTAGTTTTTGACTTGAGATGG - Intergenic
985337238 4:188909701-188909723 ATATGATTTTTTTCTTGAGATGG - Intergenic
985915627 5:2916828-2916850 ATTGGGTTTTTTAATCAAGACGG + Intergenic
986143549 5:5054809-5054831 AGCTGGTTTCTTCCTTATGAGGG - Intergenic
986875596 5:12104180-12104202 ATGTTGTTTTTTAGTTAAGTAGG + Intergenic
987736823 5:21856903-21856925 ATCTGCTCTTTCACTAAAGAAGG - Intronic
987995645 5:25274867-25274889 ATCTTATTTTTTAGTTAAAACGG + Intergenic
988303587 5:29466153-29466175 AGCTGGTTTTTTAGTAGAGAAGG - Intergenic
988360022 5:30225423-30225445 ATCTGGTATTATATTTGAGAAGG + Intergenic
989273854 5:39563883-39563905 TGCTGGTTTTCCACTTAAGATGG - Intergenic
989676848 5:43982702-43982724 ATCTGGTTGTTTACTTTACTTGG - Intergenic
991353707 5:65746630-65746652 TTTTGTTTTTTTACTTAAGGTGG + Intronic
991514452 5:67418793-67418815 ATCTGGTTCTTTATTTATGTAGG + Intergenic
992178649 5:74175297-74175319 AACTGGTCTTTAACTGAAGATGG - Intergenic
993989652 5:94640202-94640224 ATCTCATTTTTTATTTGAGAAGG + Intronic
994795240 5:104290729-104290751 ATCAAGTTTTTAACTTCAGATGG + Intergenic
995511911 5:112918896-112918918 AACTGTTTATTTACTTTAGAGGG + Intronic
995634072 5:114165459-114165481 AATTGGTTTATTACTTAATATGG + Intergenic
996189629 5:120523029-120523051 ATCTGCTTTTTGACTTAATTTGG + Intronic
998964846 5:147528001-147528023 ATTTTGTTTTTTCCTTAAGTAGG - Intergenic
1000220034 5:159206400-159206422 ATGTGCTCTTTTACTTTAGAAGG - Intronic
1000684132 5:164225751-164225773 ATCTGCTTGTGTACTTATGAAGG + Intergenic
1000833829 5:166132490-166132512 TTCTGGGTTTTTAATAAAGAGGG + Intergenic
1000894918 5:166844002-166844024 TTCTGTTTTTTTTCTTAAGTTGG + Intergenic
1001084063 5:168687504-168687526 CTCTGGTTTCTTCCTTACGATGG - Intronic
1001410299 5:171506586-171506608 AAATTGTTTTTTACTTTAGAGGG + Intergenic
1008724491 6:54400420-54400442 ATCTGGAATTTTATTTAAGTTGG + Intergenic
1008827157 6:55710166-55710188 ATCTCATTTTTTAATTAAAAAGG - Intergenic
1010315282 6:74441739-74441761 TCCTGGTTTTTTTTTTAAGAAGG - Intergenic
1010583805 6:77632769-77632791 ATCTGGTTTCTTATTTTTGACGG + Intergenic
1010601018 6:77826648-77826670 AACTTGTTTTTCACTTTAGAGGG + Intronic
1010704964 6:79096808-79096830 ATCTGTTTTGTTACTTAGTATGG + Intergenic
1011615189 6:89191765-89191787 GTGTGGTTTGTGACTTAAGAGGG - Intronic
1012153298 6:95783373-95783395 ATTTGGTATTTTACTTAATAAGG - Intergenic
1012430317 6:99157337-99157359 AGCTTCTTTTTTAATTAAGAAGG - Intergenic
1013088968 6:106882150-106882172 ATCTGGAATTTTATTTAAAAAGG + Intergenic
1014508996 6:122297251-122297273 TTCTAGTTTTTTATTTAAAATGG + Intergenic
1016736730 6:147487739-147487761 ATCTGGTCTTTTACAGAAAAAGG + Intergenic
1017144387 6:151220852-151220874 ATCTTTTTTTTTTTTTAAGATGG - Intergenic
1018508734 6:164501533-164501555 ATCTGGTTTTTAAATTGTGATGG - Intergenic
1018555358 6:165044060-165044082 CTCTGGATTATTTCTTAAGATGG + Intergenic
1018716751 6:166538938-166538960 TTCTTTTTTTTTTCTTAAGACGG + Intronic
1018875766 6:167821315-167821337 ATCGGTTTTTTTTCTTGAGACGG + Intergenic
1018884650 6:167924174-167924196 ATATGGCTTTTTAATTTAGAAGG - Intronic
1019372863 7:672153-672175 ATTTGTTTTTTTTTTTAAGATGG + Intronic
1020676594 7:11191578-11191600 CTCTGGTTCTTTCCTTAACAAGG - Intergenic
1020704378 7:11525373-11525395 ATCAGTTTTTTAAATTAAGAAGG + Intronic
1021710688 7:23413028-23413050 TTCTGTATTTTTAGTTAAGATGG + Intronic
1022775241 7:33520500-33520522 TCCTGGTTTTTTACTGATGAGGG + Intronic
1022775341 7:33521646-33521668 ATATGATTTTAAACTTAAGATGG + Intronic
1023255045 7:38304910-38304932 GTCTGGTTTTTTACATCAGCCGG - Intergenic
1024212009 7:47214166-47214188 AAGTGTTTTTCTACTTAAGATGG + Intergenic
1024748589 7:52436115-52436137 ATCAGGTTTTTTTTTTAAAAAGG + Intergenic
1024830999 7:53457098-53457120 ATCTGGTTGTTTACTTATTGTGG - Intergenic
1027498584 7:78919947-78919969 ATTTCATTTTCTACTTAAGAGGG + Intronic
1027872181 7:83721036-83721058 ATCTTTTTTTTTTTTTAAGACGG - Intergenic
1028590584 7:92489420-92489442 ATTTCTTTTTTTACTTAAGGAGG - Exonic
1028830415 7:95321626-95321648 ATGTGGTTGCTTATTTAAGAGGG + Intronic
1031129191 7:117811471-117811493 TTTTGATTTTTTAATTAAGATGG + Intronic
1031603513 7:123742629-123742651 AACTGCTTTTTTGGTTAAGATGG - Intronic
1031795285 7:126166578-126166600 ATCTAGTTGTTTCCTAAAGAAGG + Intergenic
1034872172 7:154694606-154694628 TTCTGGTTTTTTTTTTGAGATGG - Intronic
1036742617 8:11378209-11378231 ATCTGTTCTTTGACTTATGATGG + Intergenic
1038265129 8:26033398-26033420 TTCTGTATTTTTACTAAAGATGG + Intronic
1038750554 8:30291524-30291546 ATCTGGATTTTTGTTTAAGAGGG + Intergenic
1039046536 8:33455517-33455539 ATCTTGTTTTTTTGTTGAGATGG - Intronic
1039345796 8:36703934-36703956 TTTTTTTTTTTTACTTAAGATGG - Intergenic
1039564804 8:38543649-38543671 ATATGGTTGTTTAAATAAGATGG + Intergenic
1041022326 8:53650298-53650320 ATATGGCTTTTTGCATAAGAGGG + Intergenic
1041038162 8:53816788-53816810 CTCTGGTTTTTTTTTTGAGACGG - Intronic
1041463572 8:58137553-58137575 AGCTGTTTTTTTTTTTAAGACGG - Intronic
1042176772 8:66045089-66045111 ATCTGGTTTCTAGCTTAACAAGG + Intronic
1043295600 8:78658884-78658906 ATCTGGTTGTTTTATTAATACGG + Intergenic
1044232021 8:89789600-89789622 ATTTGTTTTCCTACTTAAGAAGG - Intronic
1044235726 8:89827874-89827896 ATCTAGTTTTTTACATAGAAAGG + Intergenic
1044334303 8:90960778-90960800 GTCTGGTTTTTTTCTGCAGATGG + Exonic
1046012192 8:108562768-108562790 ATCTGATTTTTCACTTATGTAGG + Intergenic
1047977734 8:130147836-130147858 GTCTGGTGTTTTACTCAAAAGGG - Intronic
1049987367 9:964192-964214 TTGTGGTTTTTTTTTTAAGAAGG + Intronic
1050132601 9:2428107-2428129 ATCTGGTTGTTGGCTTAGGAGGG - Intergenic
1050167833 9:2784743-2784765 ATTTTTTTTTTTACTTATGATGG - Intronic
1050386374 9:5095351-5095373 ATTTGTTTTTTTAATCAAGATGG - Intronic
1050808267 9:9711312-9711334 ATATGTTGTTTCACTTAAGACGG + Intronic
1050873763 9:10611101-10611123 ATCTGGTTTTTAACTTATAAGGG + Intronic
1050874362 9:10615614-10615636 ATCTGCCTTTTTATTGAAGAAGG - Intergenic
1050994202 9:12192882-12192904 ATCTTCTTTTTTTTTTAAGATGG + Intergenic
1051436159 9:17034810-17034832 ATATGGTTTTTTAGAAAAGACGG + Intergenic
1052489780 9:29150556-29150578 ATTTGCTTTTTTTCTTAAAATGG - Intergenic
1053941941 9:43259739-43259761 AACTGATTTTTTTTTTAAGAAGG - Intergenic
1054821681 9:69527869-69527891 ATCTGATTTTTTACCTTAAAGGG + Intronic
1057536884 9:95918870-95918892 GTCTGTTTTTTTTTTTAAGACGG + Intronic
1059663271 9:116422401-116422423 ACTTAGTTTTTGACTTAAGATGG + Intergenic
1060438248 9:123614809-123614831 ATCAGGGTATTTAATTAAGAAGG - Intronic
1060838602 9:126777153-126777175 TTCTTTTTTTTTTCTTAAGATGG - Intergenic
1185775448 X:2799485-2799507 CTGTGTTTTTTTACATAAGATGG + Intronic
1186141857 X:6583798-6583820 GTTTGTTTGTTTACTTAAGAAGG + Intergenic
1187974656 X:24693411-24693433 TTCTGGTTATTTGGTTAAGACGG + Intergenic
1188042569 X:25386778-25386800 ATGAGGTTTTTTTCTTAAGAAGG + Intergenic
1188941472 X:36242467-36242489 GTTTGGTTTTTTTCTTAAAATGG - Intronic
1189205200 X:39232092-39232114 ATCTTGTTTTTTATTTAGCATGG - Intergenic
1189253231 X:39617439-39617461 GTTTGGTTTTTTATTTAAGATGG + Intergenic
1191878851 X:65824159-65824181 AGCTGGTTTTTGCCTTAAGATGG + Intergenic
1192106037 X:68317900-68317922 GTTTGTTTTTTTACTTGAGATGG - Intronic
1192422895 X:71049772-71049794 TTTTTGTTTTTTACTGAAGATGG - Intergenic
1193140893 X:78025512-78025534 ATTTGTTTTTTTTCTTAATATGG - Intronic
1193420533 X:81277964-81277986 ATCTCCTTTTTTTCTTGAGATGG + Intronic
1193692519 X:84664443-84664465 TTCTGGTGTTATACTTAAGAAGG + Intergenic
1195040269 X:101007733-101007755 ATTTGCATTTTTTCTTAAGAGGG + Intergenic
1195545375 X:106107061-106107083 ATCTGGTAGTTTCATTAAGAGGG + Intergenic
1198797765 X:140417105-140417127 ATCTGCTTTTTAAGATAAGATGG - Intergenic