ID: 1095810344

View in Genome Browser
Species Human (GRCh38)
Location 12:46367936-46367958
Sequence CAGCTTGGACAACATAACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095810342_1095810344 -8 Left 1095810342 12:46367921-46367943 CCAGGAGTTCGAGATCAGCTTGG 0: 30
1: 1399
2: 17880
3: 64092
4: 68197
Right 1095810344 12:46367936-46367958 CAGCTTGGACAACATAACATAGG 0: 1
1: 0
2: 0
3: 13
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095810344 Original CRISPR CAGCTTGGACAACATAACAT AGG Intronic
900723836 1:4201592-4201614 AAGTTTGGGAAACATAACATGGG + Intergenic
901943187 1:12679540-12679562 CAGCCTGGACAACATAATGATGG + Intergenic
902421622 1:16285300-16285322 CAGCCTGGGCAACAGAGCATGGG - Intronic
905091135 1:35432379-35432401 CAGCTCGGGCAACAGAACAGTGG - Intergenic
907482219 1:54753133-54753155 CAGCCTGGACAACATAACCCGGG - Intergenic
908130934 1:61074872-61074894 TAGCATTGACAACATAGCATTGG - Intronic
908349529 1:63270817-63270839 AGGCTGGGACAAAATAACATAGG + Intergenic
913169146 1:116216500-116216522 CAGCTTGGGCAACATAGCCAAGG + Intergenic
916774081 1:167941803-167941825 CATCTTGGACAAAATAACTAGGG + Intronic
917854517 1:179089920-179089942 CAGCTTGGAAAACCTCACCTGGG + Intronic
918574830 1:186045198-186045220 CAGCGTGCAAAACATAAAATTGG - Intronic
924301482 1:242643427-242643449 CAGCTTGAACATAATAACAAAGG - Intergenic
1063650483 10:7931656-7931678 GAGATTTGAAAACATAACATGGG - Intronic
1064373124 10:14771709-14771731 CAGCCTGGGCAACATAACGAAGG - Intronic
1064465309 10:15574014-15574036 CAGCCTGGCCAACATAGCAAGGG - Intronic
1064692588 10:17933139-17933161 CACCTAGGACATAATAACATAGG + Intergenic
1065529091 10:26650736-26650758 CAGCCTGGGCAACAGAACAAGGG + Intergenic
1067517248 10:46961842-46961864 CAGAATGGACAAAATAACAAAGG - Intronic
1067645000 10:48089987-48090009 CAGAATGGACAAAATAACAAAGG + Intergenic
1069414651 10:68187270-68187292 CAGCCTGGGCAACAAAACAGAGG + Intronic
1072050230 10:91697064-91697086 CAGCTTGGGCAACATAGCCACGG - Intergenic
1074551757 10:114449654-114449676 CAGCTTGGAAAACACTACATAGG + Intronic
1076716629 10:132368693-132368715 CAACTTTTACAAGATAACATAGG + Intronic
1083694172 11:64431606-64431628 CAGCCTGGGCAACATAGCAAGGG - Intergenic
1086760225 11:90620792-90620814 CAACTTGGAAAACATATCTTAGG + Intergenic
1088614399 11:111609838-111609860 CAGCTTATACAACAAATCATTGG - Intronic
1091149508 11:133314521-133314543 CAGCATGGAAAACATAGCAGAGG - Intronic
1095810344 12:46367936-46367958 CAGCTTGGACAACATAACATAGG + Intronic
1096885261 12:54712269-54712291 CATTTTGGAAAACAAAACATAGG - Intergenic
1097553832 12:61112555-61112577 CAACTTCTAGAACATAACATAGG + Intergenic
1098758446 12:74393011-74393033 CTGCTTGGAAAATAGAACATAGG + Intergenic
1104628145 12:130376872-130376894 CAGCTGGGATGACACAACATGGG - Intergenic
1109209241 13:59515475-59515497 CAGCTTGGACAAAAGAAAAGGGG + Intergenic
1114205726 14:20569641-20569663 CAGCTGGGAGAACACCACATTGG + Intergenic
1115553272 14:34523565-34523587 CAGCCTGGGCAACAAAACAAAGG - Intronic
1115732253 14:36284005-36284027 GAGCTTTGAAAACATAACAATGG - Intergenic
1118863773 14:69686249-69686271 AATCTTGGACAACATAACCTGGG - Intronic
1120662932 14:87271909-87271931 CAGGGTGGATAAGATAACATAGG - Intergenic
1121436170 14:93921662-93921684 CAGCTCGGGGAACATAACAAAGG - Intronic
1123777348 15:23593037-23593059 CAGCTTGGACAAAATTAGCTGGG + Intronic
1126367938 15:47915270-47915292 CAGCATGGACAGCTGAACATGGG + Intergenic
1127643250 15:60934930-60934952 CGGCTTAGACAACATAAGCTTGG - Intronic
1128532871 15:68466512-68466534 CAGCCTGGGTAACATAACCTGGG + Intergenic
1129225181 15:74165721-74165743 CAGCCTGGGCATCATGACATTGG + Intergenic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1130179919 15:81615274-81615296 CATTTTGGAAAACATAGCATTGG - Intergenic
1130836798 15:87658634-87658656 CAGCTTTAACAACACAAGATAGG + Intergenic
1135510168 16:23075889-23075911 CAGTCTGGACAACATAGTATAGG + Intronic
1139307908 16:66003659-66003681 CAGCTTGTACAACTGCACATTGG - Intergenic
1141209891 16:81968347-81968369 AAGCTTGGGCAACAAAACAAAGG - Intergenic
1143424603 17:6824489-6824511 TAGCTTGGACAAAATAATAAAGG - Intronic
1143494611 17:7305307-7305329 CAGACTGGGCAACATAACAACGG - Intergenic
1149537260 17:57442626-57442648 CATCTTGGGCAACAGAACCTGGG - Intronic
1152847611 17:82611786-82611808 CAGCATGGACAACTCAAGATGGG + Intronic
1153725397 18:7949090-7949112 CAGCATGGATAATATACCATTGG + Intronic
1155463714 18:26112502-26112524 CAGCTTGGAAAACATATATTAGG - Intergenic
1155829537 18:30495672-30495694 CAACTTGGAAAACATAATACGGG + Intergenic
1156541118 18:37911581-37911603 CAGCTTTTAAAACATAACATTGG - Intergenic
1165961198 19:39535840-39535862 GAGGTTGGAAAACATAAAATAGG + Intergenic
1166747797 19:45150069-45150091 CAGCTTGTACCACGTAACAGAGG + Exonic
1167261228 19:48459588-48459610 CAGCCTGGACAACATAGCAAGGG - Intronic
925943551 2:8840769-8840791 CAGGTTGGAGAACATCACTTTGG - Intergenic
927170219 2:20363035-20363057 CAGCCTGGGCAACATAGCAAAGG + Intergenic
927177999 2:20423811-20423833 CTCCTTGGACAAAATAACATAGG - Intergenic
928099536 2:28427969-28427991 AAGCTTGGACAACTGGACATTGG + Intergenic
929198975 2:39215163-39215185 CAGATTGGCAAACATAACATTGG - Intronic
933542729 2:83668423-83668445 CTATTTGGACAACAAAACATAGG + Intergenic
937085293 2:119167678-119167700 CAGCTTTGACAACATCAAAAGGG + Intergenic
937589993 2:123601317-123601339 CAGATTGGAAAACATATTATTGG + Intergenic
937864556 2:126739203-126739225 CAGCTTGGCTCACATAACACAGG + Intergenic
940605443 2:155918013-155918035 AAGCTTGGAGAACATAACTGTGG + Intergenic
940974848 2:159931226-159931248 CAGTTTGTAAAACATAAAATAGG + Intergenic
941257384 2:163249710-163249732 CAGCGTGGAAACCATAATATAGG + Intergenic
943267729 2:185757066-185757088 CAGCTTTTACAACATACCAAAGG + Intronic
945700866 2:213169713-213169735 CCACTTGGAGAATATAACATTGG + Intergenic
947057791 2:226126840-226126862 CAGATTAGAGAACATAACTTTGG + Intergenic
947229318 2:227869534-227869556 GAGGTTGGAAAACATAAAATGGG - Intergenic
949008499 2:241664933-241664955 CAGCCTGGACAACAGAGAATCGG + Intronic
1169364201 20:4978002-4978024 CAGCCTGGGCAACATAACAAGGG + Intronic
1170910614 20:20563592-20563614 CACCTTGGACATTATAGCATAGG - Intronic
1172079249 20:32326300-32326322 CAGCTTGGACAACGAGCCATGGG + Intronic
1174791197 20:53480041-53480063 CAGCATGGACAACATAACCCAGG + Intronic
1177378646 21:20308237-20308259 CAGCTTGGAGAACAGAACCCTGG - Intergenic
1177567123 21:22838530-22838552 CAGCATGGACAACAGATTATGGG + Intergenic
1178240570 21:30894895-30894917 CAGCTTGGACAACTTCACAGTGG - Intergenic
1178693001 21:34765317-34765339 CAGCTTTGACAGCATGTCATGGG + Intergenic
1181092260 22:20481944-20481966 CAGCCTGGACACCATAGCAAGGG - Intronic
1184063286 22:42098910-42098932 CAGCCTGGACAACATAGGAGGGG - Intergenic
1184952071 22:47850541-47850563 CAGCTTGGACAATCTACCACCGG - Intergenic
949583087 3:5410615-5410637 CAGCTGGGACAAAATCACACTGG + Intergenic
950745164 3:15082212-15082234 TAGCTGGGAAATCATAACATGGG + Intronic
951362302 3:21739653-21739675 CAGCTTGCCCATCATAACAAGGG + Intronic
951509178 3:23482515-23482537 CAGCGTGGGCAGCATGACATAGG - Intronic
955878279 3:63517185-63517207 CAACAAGGACAACATAGCATAGG + Intronic
961203522 3:125062846-125062868 CAGCCTGGACAAAATGACACTGG - Intergenic
962233934 3:133692189-133692211 CTGCCTGGGCAACAGAACATGGG + Intergenic
962516438 3:136156358-136156380 GAGGTTGGAAAACATAAAATGGG + Intronic
964585561 3:158295343-158295365 TAGCTTTGACAAGATAACAGAGG + Intronic
969085118 4:4650784-4650806 CAGCTTGCTCAAGATAACAAGGG + Intergenic
975096321 4:70461087-70461109 CAGCTTGGCCAAGATAAGCTCGG - Intronic
975682540 4:76890717-76890739 CAGCCTGGGCAACATAGCCTGGG + Intergenic
978657585 4:111083198-111083220 TAGTTTGGAGAACATATCATGGG - Intergenic
978975930 4:114872409-114872431 CAGATTGGTCAGCGTAACATTGG - Intronic
979572290 4:122241927-122241949 CAGCTTCAAAAACAGAACATAGG + Intronic
980712067 4:136582016-136582038 CAGCATGGCCAACATAGCAATGG - Intergenic
982938422 4:161516920-161516942 CAGCCTGGGCAACAGAGCATGGG - Intronic
982973417 4:162021038-162021060 CAACTTGAACAATATAAAATGGG - Intronic
983923588 4:173371874-173371896 CAGCTTGGGCAGCAAAACAAAGG - Intronic
984146849 4:176071948-176071970 CATCTTGGTCAACAAAACACAGG - Intronic
984939579 4:184919370-184919392 CATCTTGGACAACATAAGTCTGG + Intergenic
985821348 5:2162702-2162724 CAGCTTGAATAACATGACATAGG - Intergenic
986027766 5:3866456-3866478 GAGCTTGGACACCTGAACATGGG - Intergenic
986720250 5:10555989-10556011 CAGCCTGGGCAATATAGCATAGG + Intergenic
989981538 5:50651687-50651709 CAACTTTGACATCATACCATTGG + Intergenic
990137039 5:52658451-52658473 AAGCTTGGAAAAGATAAGATTGG + Intergenic
990245922 5:53863403-53863425 AAGCTTGGACAACGGAACATGGG - Intergenic
992022132 5:72635058-72635080 CTGCTTGGACCACAAAAAATGGG - Intergenic
992398420 5:76388823-76388845 CAGCTGGGTCTACATAACCTAGG - Intergenic
993693676 5:91034812-91034834 CAGCCTTGGCAACATAACAGGGG - Intronic
997588698 5:135059986-135060008 CAGTTTGGACATCATGGCATTGG + Intronic
997803892 5:136894057-136894079 AAGCTTGTAGAAAATAACATAGG - Intergenic
1003758040 6:9144376-9144398 CAGCTATGTCAAGATAACATAGG - Intergenic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1008638136 6:53432869-53432891 CAGCTGAGACAACAAATCATGGG - Intergenic
1008890955 6:56489485-56489507 CAACTTGCACAACATAAGGTGGG - Exonic
1013600779 6:111702884-111702906 CAGCTTGTACAACATTACTCAGG - Exonic
1015478277 6:133677945-133677967 CAGCTTCTAGAATATAACATAGG - Intergenic
1016449222 6:144164037-144164059 CAGCTTGGTGAGCAAAACATAGG - Intronic
1016850870 6:148617736-148617758 CTGTTTGGATTACATAACATAGG - Intergenic
1018326393 6:162674489-162674511 CAGATTGGACAACATAACTAAGG + Intronic
1022403360 7:30063091-30063113 AAGCTTGAACACCATAACAGCGG + Intronic
1025920661 7:65909073-65909095 CAGCCTGGCCAACATAGCCTTGG + Intronic
1026809135 7:73447605-73447627 CAGTTTGGACAAGATACCAAAGG + Intronic
1029330596 7:99850550-99850572 CAGCCTGGGCAACATAAAAAAGG - Intronic
1030228329 7:107177653-107177675 GAGCTTTGAAAAAATAACATAGG + Intronic
1031472376 7:122182404-122182426 CAGCTTAGACACAATAAGATAGG + Intergenic
1033261057 7:139844365-139844387 TTGCTGGGACAACAGAACATAGG - Intronic
1034310437 7:150083145-150083167 CAGCCTGGACAACATAGTACGGG - Intergenic
1034796405 7:154017496-154017518 CAGCCTGGACAACATAGTACGGG + Intronic
1043278841 8:78437706-78437728 CAGCTTGCACAGCAAATCATGGG - Intergenic
1047882430 8:129211069-129211091 CAGGATGGCCAACAGAACATTGG - Intergenic
1048401771 8:134077806-134077828 CTGCGTGGAGAACAGAACATAGG - Intergenic
1049619318 8:143590876-143590898 CAGCCTGGACAACAGAGCAGGGG + Intronic
1054348933 9:64000051-64000073 CAGATTGTGCAACATAACAGAGG + Intergenic
1055075240 9:72207913-72207935 CAGCCTGGGCAACATAGCAAGGG + Intronic
1055139653 9:72861709-72861731 CAGCCTTGAAAAGATAACATTGG - Intergenic
1056074376 9:83023633-83023655 AAGCTTGGTTAACATAACCTCGG - Intronic
1056876865 9:90342028-90342050 CAACTTGTCCAACATAACCTTGG + Intergenic
1057315594 9:93966444-93966466 CAGCATGGACAAGAGAACAAGGG + Intergenic
1058621552 9:106888566-106888588 CAGTTTGGAAAACATAACTGGGG + Intronic
1058823536 9:108754483-108754505 CAGCTTGGACATCATACAAAAGG + Intergenic
1188546849 X:31317295-31317317 CAGCTAAGACAACATTAAATAGG - Intronic
1190858503 X:54320725-54320747 CAGCCTGGTCAACATAGCAAGGG - Intronic
1193703574 X:84792548-84792570 CAACTTGGAAAACATAATTTAGG + Intergenic
1194835751 X:98680996-98681018 CAATATGGACAACATAATATTGG - Intergenic
1195684328 X:107571870-107571892 CAGCTTTGAGAAAATAGCATTGG - Intronic
1196117380 X:112012230-112012252 TAGGTTGAACCACATAACATTGG + Intronic
1198103682 X:133442765-133442787 CAGCCTGGGCAACATAGCCTGGG + Intergenic