ID: 1095810768

View in Genome Browser
Species Human (GRCh38)
Location 12:46371928-46371950
Sequence AACCCCCAGCTCCCGGGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 962
Summary {0: 1, 1: 1, 2: 3, 3: 89, 4: 868}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095810768_1095810776 30 Left 1095810768 12:46371928-46371950 CCGGGCCCCGGGAGCTGGGGGTT 0: 1
1: 1
2: 3
3: 89
4: 868
Right 1095810776 12:46371981-46372003 CACACCCGTCCACAGGCAGCTGG 0: 1
1: 0
2: 0
3: 19
4: 216
1095810768_1095810775 23 Left 1095810768 12:46371928-46371950 CCGGGCCCCGGGAGCTGGGGGTT 0: 1
1: 1
2: 3
3: 89
4: 868
Right 1095810775 12:46371974-46371996 CCTCAAGCACACCCGTCCACAGG 0: 1
1: 0
2: 0
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095810768 Original CRISPR AACCCCCAGCTCCCGGGGCC CGG (reversed) Intronic
900127200 1:1073870-1073892 AGTCCCCAGGTCCCGGTGCCTGG - Intronic
900166853 1:1247326-1247348 CACCCCCAGGACCCTGGGCCGGG - Intergenic
900669274 1:3840316-3840338 AACCTCCACCTCCCGGGTTCAGG + Intronic
900671589 1:3857858-3857880 AACCCCAGGCTGCGGGGGCCCGG - Intronic
901251875 1:7784896-7784918 GCCCCCCGTCTCCCGGGGCCAGG - Exonic
901253450 1:7799526-7799548 AACCTCCGCCTCCCGGGTCCCGG - Intronic
901439114 1:9266900-9266922 AACCTCCACCTCCCGGGTTCAGG + Exonic
901839230 1:11943590-11943612 AACCCCCAGGTTCCGTGGCCAGG - Intronic
902045990 1:13524809-13524831 AACCTCCACCTCCCGGGTTCAGG - Intergenic
902317083 1:15629811-15629833 AACCTCCACCTCCCGGGTTCAGG + Intronic
902672295 1:17983222-17983244 AGCCCTCAGCTCCCAGGGGCTGG - Intergenic
903177273 1:21588616-21588638 AACCTCCATCTCCCGGCTCCAGG - Intergenic
903386124 1:22928052-22928074 AACCTCCACCTCCCGGGTTCAGG - Intergenic
904103322 1:28052857-28052879 AACCTCCACCTCCCGGGTTCAGG - Intronic
904104405 1:28065925-28065947 AACCTCCGCCTCCCGGGTCCTGG - Intronic
904481810 1:30798648-30798670 AAACTCCAGCGCCTGGGGCCAGG - Intergenic
904818013 1:33220114-33220136 AGCCCACAGCCTCCGGGGCCTGG - Intergenic
905068022 1:35200191-35200213 AACCTCCAACTCCTGGGTCCTGG - Intergenic
905328037 1:37171842-37171864 AGCTCCCAGCTCCTTGGGCCCGG + Intergenic
905584411 1:39105579-39105601 AACCGGCAGCCCCCGGGGCTCGG + Intronic
905807204 1:40885485-40885507 AACCTCCACCTCCCGGGTTCAGG - Intergenic
906002537 1:42439345-42439367 AACCTCCACCTCCCGGGTTCAGG + Intronic
906066832 1:42986619-42986641 AACCTCCACCTCCCGGGTTCAGG - Intergenic
907241583 1:53084108-53084130 CTTCCCCAGCTCCCAGGGCCCGG + Intronic
908141730 1:61192039-61192061 AACCTCCACCTCCCGGGTTCAGG + Intronic
908273609 1:62445895-62445917 AACCTCCACCTCCCGGGTTCAGG - Intronic
908353810 1:63312280-63312302 AACCTCCACCTCCGGGGTCCCGG + Intergenic
908356513 1:63328819-63328841 CACCCCCAGCTCCAGGGGCAGGG + Intergenic
908812585 1:67998638-67998660 AACCTCCACCTCCCGGGTTCAGG - Intergenic
910259161 1:85279208-85279230 AACCACAACCTCCTGGGGCCTGG - Intergenic
910586005 1:88879975-88879997 AACCTCCACCTCCCGGGTTCAGG - Intronic
911125363 1:94336489-94336511 AACCTCCACCTCCCGGGTTCAGG - Intergenic
911188433 1:94926385-94926407 GTCCGCCAGCACCCGGGGCCCGG + Intronic
911477281 1:98389236-98389258 AACCTCCACCTCCCGGGTTCAGG + Intergenic
911578956 1:99612982-99613004 AACCTCCACCTCCCGGGTTCAGG - Intergenic
912470690 1:109904851-109904873 GAACCCCTGCTCCAGGGGCCAGG - Intergenic
912783235 1:112573264-112573286 AACCTCCACCTCCCGGGTTCAGG - Intronic
913154045 1:116076831-116076853 AACCTCCACCTCCCGGGTTCAGG - Intergenic
913184442 1:116356175-116356197 AACCTCCACCTCCCAGGCCCAGG - Intergenic
914241045 1:145853326-145853348 AACCTCCACCTCCCGGGTTCAGG - Intronic
914254427 1:145949896-145949918 AACCTCCACCTCCCAGGCCCAGG + Intronic
914661307 1:149793026-149793048 GCCCGCCAGCTCCCGGGCCCCGG + Intronic
915217282 1:154348751-154348773 GACCCACAGCACCCGGGACCAGG - Intronic
915353171 1:155239134-155239156 AACCTCCACCTCCCGGGTTCAGG - Intronic
915423689 1:155806232-155806254 AACCTCCATCTCCCGGGTTCGGG + Intronic
915426586 1:155832191-155832213 AACCTCCACCTCCCGGGCTCAGG - Intronic
915498760 1:156299894-156299916 AACCTCCAACTCCCGGGTTCAGG - Intergenic
915598244 1:156907407-156907429 CACCCCCACCTGCCGGTGCCAGG + Intronic
915735342 1:158081028-158081050 GCCCCCCAGCTCCCCAGGCCAGG + Intronic
915977354 1:160400210-160400232 AGCCCCCAGATCCCTGGGGCTGG - Intergenic
915996430 1:160568700-160568722 AACCTCCACCTCCCGGGTTCAGG + Intronic
916747497 1:167695618-167695640 AACCCCCACCTCCTGGGCTCAGG + Intronic
917303958 1:173608397-173608419 AACCTCCACCTCCCGGGCTCAGG + Intergenic
917757904 1:178121565-178121587 AACCTCCATCTCCCGGGTTCAGG + Intronic
918574938 1:186046385-186046407 AACCTCCACCTCCCGGGTTCAGG - Intronic
918788405 1:188794186-188794208 AACCTCCGCCTCCCGGGTCCCGG - Intergenic
919821609 1:201476513-201476535 AGCCCCCAGCTCCCAGGGAGAGG - Intergenic
919892072 1:201982820-201982842 AGCCCCCGGCTCCCTGCGCCGGG - Exonic
920140536 1:203808910-203808932 AACCTCCACCTCCCGGGTTCAGG + Intronic
920156815 1:203958625-203958647 AACCTCCACCTCCCGGGTTCAGG - Intergenic
920251421 1:204624758-204624780 GACCCTCAGCTCCCGGGGGGGGG - Intronic
920319943 1:205112234-205112256 AACCTCCACCTCCCGGGTTCAGG - Intronic
920332574 1:205221034-205221056 AACCTCCACCTCCCGGGTTCAGG + Intergenic
920501691 1:206489618-206489640 AACTCCCAGCTCCCAGGCTCAGG - Intronic
920639586 1:207739202-207739224 AACCTCCACCTCCCGGGTTCAGG + Intergenic
920700976 1:208217884-208217906 CACCTCCAGGGCCCGGGGCCAGG + Exonic
921046595 1:211482138-211482160 AACCTCCACCTCCCGGGTTCAGG - Intronic
921876407 1:220201579-220201601 AACCTCCACCTCCCGGGTTCAGG + Intronic
921934868 1:220786997-220787019 AACCCCGAGCCACCCGGGCCGGG - Exonic
922513111 1:226186333-226186355 CACGCCGGGCTCCCGGGGCCGGG + Intronic
922600154 1:226845065-226845087 AACCTCCACCTCCCGGGTTCAGG - Intergenic
923078447 1:230631121-230631143 AACCTCCACCTCCCGGGTTCAGG - Intergenic
923175340 1:231458393-231458415 AACCTCCACCTCCTGGGTCCAGG - Intergenic
923213364 1:231827068-231827090 AACCTCCACCTCCCGGGTTCAGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
923480037 1:234375223-234375245 AACCTCCACCTCCCAGGTCCTGG - Intronic
923578693 1:235186490-235186512 AACCTCCACCTCCCGGGTTCAGG + Intronic
923609013 1:235472988-235473010 AAACCCCACCTCCCAGGTCCTGG + Intronic
923631092 1:235649897-235649919 AGCCCCCAGCGTCCAGGGCCGGG - Exonic
923723961 1:236490383-236490405 AACCTCCACCTCCCGGGTCCCGG - Intergenic
923950974 1:238953332-238953354 AACCTCCACCTCCCGGGTTCAGG - Intergenic
924854161 1:247858840-247858862 AACCTCCGTCTCCCGGGTCCTGG + Intronic
1063163148 10:3434583-3434605 AACCTCCACCTCCCAGGTCCAGG + Intergenic
1063455452 10:6179450-6179472 AACCCCCAGCTGCAAGGGGCAGG + Intronic
1063618885 10:7626573-7626595 AACCCCCAGCTCCAGGGTCCCGG - Intronic
1063695851 10:8334299-8334321 AACCTCCACCTCCCGGGCTCAGG + Intergenic
1064642601 10:17429562-17429584 AACTCCCACCTCCCGGGCTCAGG + Intronic
1065537423 10:26728858-26728880 AACCTCCACCTCCCGGGCTCAGG + Intronic
1065636842 10:27742938-27742960 AACCCCCAACTCCGAGGTCCAGG + Intronic
1066323200 10:34326043-34326065 AACCTCCAACTCCCAGGTCCTGG - Intronic
1066550138 10:36546861-36546883 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1067065956 10:43104433-43104455 AACCTCCAACTCCCGGGTTCAGG - Intronic
1067389500 10:45850003-45850025 AACCTCCACCTCCTGGGTCCAGG + Intronic
1067855711 10:49791037-49791059 AACCCCCATCTCCCGAGTTCAGG - Intergenic
1067873763 10:49986052-49986074 AACCTCCACCTCCTGGGTCCAGG - Intronic
1069405185 10:68091474-68091496 AACCTCCAGCTCCCAGGCTCAGG + Intergenic
1069549846 10:69355708-69355730 AACCTCCACCTCCCGGGTTCAGG - Intronic
1069836947 10:71315167-71315189 ATCCTCCAGTTCCCTGGGCCTGG + Intergenic
1069993610 10:72329447-72329469 AAGCCCCAACTCCCGGGCTCTGG + Intergenic
1070136125 10:73696092-73696114 AACCTCCACCTCCCAGGTCCAGG + Intronic
1070819258 10:79345511-79345533 ACTCCCCAGCCCCTGGGGCCTGG + Intergenic
1070899505 10:80015947-80015969 AACCTCCACCTCCCGGGCTCAGG + Intergenic
1071578864 10:86752471-86752493 AGGCCCCAGCTCCCGGTGCTCGG + Intergenic
1071851094 10:89571329-89571351 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1072578596 10:96720970-96720992 AACGCCGAGCACCCAGGGCCAGG - Intergenic
1072688421 10:97553211-97553233 AACCTCCATCTCCCGGGTTCAGG + Intronic
1073064869 10:100752257-100752279 ACCCTCCAGCTCCCTCGGCCTGG + Intronic
1073115019 10:101087105-101087127 AATCCCCAGCTCCAGGGCCAGGG - Intergenic
1073266726 10:102231986-102232008 CACCCCCAGCTCCCAGAGCACGG - Exonic
1073330184 10:102665324-102665346 AACCTCCATCTCCCGGGTTCAGG - Intergenic
1074341128 10:112631045-112631067 AACCTCCACCTCCCGGCTCCCGG - Intronic
1074596993 10:114876721-114876743 ACCTGCCAGCTCCTGGGGCCAGG + Intronic
1075019852 10:118943933-118943955 AACCCCCAGCCCCAGGCCCCAGG + Intergenic
1075038231 10:119087034-119087056 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1075134610 10:119772823-119772845 AACCTCCACCTCCCGGGTCCCGG + Intronic
1075287377 10:121198788-121198810 AACCCACAGCTGCAAGGGCCTGG - Intergenic
1075854728 10:125619630-125619652 AACCTCCGCCTCCCGGGTCCAGG + Intronic
1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG + Intronic
1076558928 10:131348400-131348422 GTCCCCCAGGTCCCGGGGCGAGG + Intergenic
1076620167 10:131781968-131781990 AACTCACAGCTCCCAGGGCCAGG - Intergenic
1076839386 10:133038604-133038626 CAGCCCCAGCTCCCAGGCCCGGG + Intergenic
1076918471 10:133439094-133439116 AAGCCCCAGCCCCTGGGTCCAGG - Intergenic
1077152547 11:1078678-1078700 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152569 11:1078746-1078768 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152590 11:1078811-1078833 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152624 11:1078913-1078935 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152657 11:1079012-1079034 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152669 11:1079046-1079068 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152681 11:1079080-1079102 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152693 11:1079114-1079136 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152714 11:1079179-1079201 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152736 11:1079247-1079269 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152796 11:1079445-1079467 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152818 11:1079510-1079532 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152841 11:1079575-1079597 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152853 11:1079609-1079631 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152903 11:1079776-1079798 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152925 11:1079841-1079863 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152955 11:1079940-1079962 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077152994 11:1080073-1080095 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153016 11:1080138-1080160 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153119 11:1080457-1080479 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153281 11:1080931-1080953 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153311 11:1081027-1081049 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153356 11:1081157-1081179 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153386 11:1081253-1081275 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153452 11:1081445-1081467 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077153486 11:1081541-1081563 TCCCCCCAGCTCCCGGTGCCCGG - Intergenic
1077194596 11:1272776-1272798 AGCCCCCGGATCCCTGGGCCCGG - Intergenic
1077264704 11:1642858-1642880 GACCCCCAGCTCGGGGGTCCAGG - Intergenic
1077341769 11:2029400-2029422 GACCCCCAGCACCCTGGGGCTGG - Intergenic
1078093755 11:8283913-8283935 CCCCCACAGCCCCCGGGGCCCGG + Intergenic
1078225702 11:9389839-9389861 AACCTCCATCTCCCGGGTTCAGG + Intronic
1078234224 11:9469311-9469333 AACCTCCACCTCCCGGGTTCAGG + Intronic
1080663671 11:34317339-34317361 AACCCCCAACTCCCTTGCCCAGG - Intronic
1081252310 11:40850751-40850773 AACTCCCATCTCCCTGGGACAGG - Intronic
1081623957 11:44635594-44635616 ATCCCCCAGCACCTGGGGTCTGG + Intergenic
1081792126 11:45795571-45795593 AACCCCCAGTTCCCAGGGAGTGG + Intergenic
1082851525 11:57769238-57769260 AACCTCCACCTCCCGGGTCCCGG - Intronic
1083348573 11:62011474-62011496 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1083398312 11:62406517-62406539 AACCTCCACCTCCCGGGTTCAGG + Intronic
1083438000 11:62656159-62656181 AACCTCCACCTCCCGGGTTCAGG - Intronic
1083571002 11:63762477-63762499 AACCCGCAGGGCCTGGGGCCGGG - Exonic
1084015447 11:66377408-66377430 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1084068254 11:66718014-66718036 AATCTCCAGGTCCCTGGGCCTGG + Intronic
1084150553 11:67286108-67286130 AACCCCCAGCACCCGGGCTCAGG + Exonic
1084295145 11:68208369-68208391 AACCTCCACCTCCCAGGTCCCGG - Intronic
1084954868 11:72685806-72685828 GGCTCCCAGCTCCCAGGGCCAGG + Intronic
1084954879 11:72685836-72685858 GACTCCCAGCTTCCAGGGCCAGG + Intronic
1085025209 11:73232491-73232513 AACCTCCACCTCCTGGGCCCAGG + Intronic
1085180921 11:74535381-74535403 AACCTCCACCTCCCGGGTTCAGG + Intronic
1085346081 11:75768909-75768931 ATGCCCCGGCCCCCGGGGCCAGG - Exonic
1085636988 11:78166556-78166578 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1088178888 11:107086354-107086376 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1088231492 11:107677760-107677782 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1088498853 11:110461412-110461434 AACCTCCACCTCCCAGGCCCTGG - Intronic
1090334611 11:125954220-125954242 ACGCCCCAGCTCCTGGGCCCAGG - Intergenic
1090784967 11:130040802-130040824 AAGCCCCCGCGGCCGGGGCCAGG + Intergenic
1091074808 11:132605480-132605502 AACCTCCACCTCCCGGGTTCAGG - Intronic
1091163470 11:133448537-133448559 AACCTCCACCTCCCGGGTTCAGG + Intronic
1202824755 11_KI270721v1_random:84589-84611 GACCCCCAGCACCCTGGGGCTGG - Intergenic
1091475484 12:768215-768237 AACCTCCATCTCCCGGGTTCAGG + Intronic
1091479316 12:810163-810185 AACCTCCACCTCCCGGGTTCAGG - Intronic
1091605909 12:1951191-1951213 AACCTCCACCTCCCGGGTTCAGG - Intronic
1091710336 12:2735492-2735514 AACCCCCATGTCCCTTGGCCTGG - Intergenic
1092354271 12:7781757-7781779 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1092484894 12:8894109-8894131 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1092748594 12:11696732-11696754 AACCTCCATCTCCCGGGTTCAGG - Intronic
1093685574 12:22049821-22049843 AACCTCCACCTCCCGGGTTCAGG - Intronic
1093946801 12:25118641-25118663 AACCTCCACCTCCCGGGTTCAGG + Intronic
1094631721 12:32182362-32182384 AACCTCCACCTCCCGGGTCCAGG + Intronic
1094657953 12:32439126-32439148 CACCCCCAACTCCCAGTGCCTGG + Intronic
1095810768 12:46371928-46371950 AACCCCCAGCTCCCGGGGCCCGG - Intronic
1096187896 12:49594791-49594813 AACCTCCACCTCCCGGGTTCAGG - Intronic
1096279072 12:50236081-50236103 AACCTCCACCTCCCGGGTTCAGG - Intronic
1096283255 12:50275284-50275306 AACCCCCACCTCCTGGGTTCAGG - Intronic
1096676187 12:53227398-53227420 GAGCCCTAGCTTCCGGGGCCTGG - Exonic
1097025031 12:56048588-56048610 AACCTCCACCTCCCGGGTTCCGG - Intergenic
1097175033 12:57137712-57137734 AACCTCCACCTCCTGGGCCCAGG - Intronic
1097197917 12:57254417-57254439 AACCTCCAGCTCCTGGGTTCAGG - Exonic
1097799961 12:63903292-63903314 AACCTCCAGCTCCTGGGTTCAGG + Intronic
1100428420 12:94508886-94508908 AACCTCCACCTCCTGGGTCCCGG + Intergenic
1100641597 12:96487037-96487059 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1101101874 12:101402262-101402284 AACCTCCAGCTCCCAAGTCCTGG + Intronic
1101684130 12:107000431-107000453 AACCTCCAGCTCCCGGGTGGAGG + Intronic
1102268720 12:111511539-111511561 AACCTACACCTCCCGGGTCCTGG + Intronic
1102298015 12:111751974-111751996 AACCTCCACCTCCCGGGTTCAGG - Intronic
1102306253 12:111806885-111806907 AACCTCCACCTCCCGGGTTCAGG - Intronic
1102505987 12:113384903-113384925 AGCACCCGGCTCCCGGGGCTGGG - Exonic
1102849224 12:116223620-116223642 AACCTCCACCTCCCGGGTTCAGG - Intronic
1103244854 12:119447822-119447844 AACCTCCACCTCCCGGGTTCAGG - Intronic
1103293981 12:119870466-119870488 AACCTCCATCTCCCGGGTGCAGG - Intronic
1103351389 12:120286157-120286179 AACCTCCACCTCCCGGGTTCGGG - Intergenic
1103359096 12:120342973-120342995 TGCCCCCAACTCCCCGGGCCCGG - Exonic
1103434470 12:120914270-120914292 TACCTCCACCTCCCGGGTCCCGG - Intergenic
1103608637 12:122107199-122107221 AACCCCCAGCTCCCGCCACGAGG - Intronic
1103633735 12:122285306-122285328 AACCTCCACCTCCCGGGTTCAGG + Intronic
1103663303 12:122539861-122539883 AACCACCAGCTCCCAGGTTCAGG + Intronic
1103864633 12:124042198-124042220 ACGCCACAGCTCCCGGGGCTGGG + Intronic
1103923582 12:124411854-124411876 AGCCCCCACCTCCCGGAACCTGG - Intronic
1104144757 12:126022291-126022313 AACCCCCACCTCCTGGGTCCAGG + Intergenic
1104184516 12:126417050-126417072 AACCTCCATCTCCCGGGTTCAGG - Intergenic
1104289286 12:127454243-127454265 AGCTCCCAGCTCCCTGGGGCTGG - Intergenic
1105387948 13:19949330-19949352 AACCTCCACCTCCCAGGTCCCGG - Intergenic
1105464031 13:20620645-20620667 AACCTCCACCTCCCGGGTTCAGG + Intronic
1105541694 13:21321538-21321560 ACCTTCCAGCTCCCAGGGCCTGG + Intergenic
1105606528 13:21930709-21930731 AAGCCCCAGCTGCTGGTGCCTGG + Intergenic
1105830741 13:24161260-24161282 CGCTCCCAGCTCGCGGGGCCTGG + Intronic
1105844815 13:24285154-24285176 AATCACCTGCTCCCGTGGCCAGG + Intronic
1106070656 13:26407696-26407718 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1106214738 13:27685916-27685938 AAACCCCAGCTCCAGAGCCCTGG + Intergenic
1106321413 13:28643133-28643155 AACCTCCACCTCCCGGGTCCTGG + Intergenic
1106335366 13:28778416-28778438 AGGCCCCAGCTCCCTGGGCCAGG - Intergenic
1106361854 13:29038664-29038686 AACTCCCATCTCCCTGGGACAGG - Intronic
1106442138 13:29784985-29785007 AACCTCCGGCTCCCGGGTTCAGG + Intronic
1107278747 13:38708570-38708592 AACCTCCATCTCCCGGGTTCAGG - Intronic
1107321338 13:39192019-39192041 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1107920102 13:45197425-45197447 AACCTCCACCTCCCGGGCTCAGG - Intronic
1108247864 13:48535335-48535357 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1108290285 13:48953257-48953279 AACCTCCACCTCCCAGGTCCCGG + Intergenic
1108620390 13:52177140-52177162 AACCTCCACCTCCTGGGTCCTGG - Intergenic
1108666354 13:52635910-52635932 AACCTCCACCTCCTGGGTCCCGG + Intergenic
1109622849 13:64931271-64931293 AACCTCCACCTCCCAGGTCCTGG - Intergenic
1110762325 13:79244341-79244363 AACCCCCACCTCCCAGGCTCAGG + Intergenic
1110832376 13:80046145-80046167 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1111173074 13:84555008-84555030 AACCTCCACCTCCCGGGCTCAGG - Intergenic
1111551642 13:89819754-89819776 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1111988074 13:95085356-95085378 AACCTCCAGCTCCCAGGTTCAGG - Intronic
1113102577 13:106736318-106736340 ATCCCCCAGATCTCGGAGCCTGG - Intergenic
1113491838 13:110698436-110698458 AACCTCCACATCCCGGGGTCAGG - Intronic
1113493913 13:110713560-110713582 AGCCCGCAGCCCCCAGGGCCTGG + Intronic
1113588645 13:111482978-111483000 AGTCTGCAGCTCCCGGGGCCAGG + Intergenic
1113628320 13:111862990-111863012 CACCTTCAGTTCCCGGGGCCTGG - Intergenic
1113709676 13:112455093-112455115 CACCCCCAGCTCAGTGGGCCTGG - Intergenic
1113727507 13:112616150-112616172 TCCCCCCAGCTCCAGGTGCCGGG + Intergenic
1113727621 13:112616905-112616927 AAGCCACAGTTCCCGGGGTCAGG - Intergenic
1115736990 14:36342844-36342866 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1115985496 14:39100923-39100945 AACCTCCACCTCCCGGGTTCAGG + Intronic
1116453185 14:45087177-45087199 AACCTCCACCTCCTGGGGCTTGG + Intronic
1117148625 14:52862144-52862166 AACCTCCACCTCCCGGGTACAGG + Intronic
1117535495 14:56698902-56698924 AACCTCCACCTCCCGGGTTCGGG + Intronic
1118304138 14:64640388-64640410 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1118340552 14:64892919-64892941 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1118600241 14:67466911-67466933 AACCTCCACCTCCCGGGTTCAGG - Intronic
1118778820 14:68992477-68992499 AACTCCCAGAGCCCGGGACCTGG - Intergenic
1119273790 14:73333944-73333966 AACCTCCACCTCCCGGGATCAGG + Intronic
1119364385 14:74079326-74079348 AACCTCCACCTCCCGGGTTCAGG + Intronic
1119429317 14:74555565-74555587 AACGCCCTGCCCCCGGGACCAGG - Exonic
1119855992 14:77901469-77901491 AACCTCCACCTCCCGGGTTCAGG + Intronic
1119942905 14:78659999-78660021 AACCCTCAGCTACTGGGGACAGG + Intronic
1120998059 14:90431679-90431701 AACCTCCAGCTCCCAGGTTCAGG - Intergenic
1121104821 14:91273143-91273165 ACCCCCCAGCTCCCATAGCCTGG - Exonic
1121122620 14:91385491-91385513 AACCCTCACCTCCCAGGGCTGGG - Intronic
1121248462 14:92482093-92482115 AACACCCAGCACACGGGGCCTGG - Intronic
1121294599 14:92808163-92808185 AACCTCCACCTCCTGGGTCCTGG - Intronic
1121356291 14:93218010-93218032 AACCCCCACCTCCTGGGTTCAGG - Intronic
1121639026 14:95473006-95473028 AGACCCCAGCACCCGGGGGCAGG + Intronic
1122619162 14:103044449-103044471 AACCTCCACCTCCCGGGTTCAGG + Intronic
1122719545 14:103714759-103714781 AACCTCCGCCTCCCGGGTCCTGG + Intronic
1122871177 14:104639736-104639758 AACCCTCAGCCCCCGAGGCCAGG - Intergenic
1122887047 14:104714780-104714802 ACTCCCCAGGGCCCGGGGCCGGG + Exonic
1122897827 14:104769114-104769136 CACCCCCATCTCCAGAGGCCTGG - Intergenic
1122960527 14:105091926-105091948 GAACCCCAGCTCCCAGGGCCTGG + Intergenic
1123010878 14:105348991-105349013 AACTCCCAGCCCCTGGTGCCAGG + Intronic
1123034392 14:105466061-105466083 CACCAGCAGCTCCGGGGGCCTGG + Intronic
1123051298 14:105545443-105545465 AACCCCCAGGTCCCAAGGCCTGG + Intergenic
1123076710 14:105671145-105671167 AACCCCCAGGTCCCAAGGCCTGG + Intergenic
1202905933 14_GL000194v1_random:72550-72572 AGTGCCCAGCTCCCGGGCCCAGG + Intergenic
1123759319 15:23420593-23420615 AACCTCCGCCTCCCGGGTCCAGG + Intergenic
1123859903 15:24454377-24454399 AACCTCCACCTCCCGGGTTCTGG - Intergenic
1124043993 15:26130952-26130974 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1124342291 15:28897534-28897556 AACCTCCACCTCCCGGGTTCAGG - Intronic
1124832440 15:33162091-33162113 AACCTCCAGCTTCTGGGCCCAGG + Intronic
1125693942 15:41619805-41619827 AACCTCCATCTCCCGGGTTCAGG - Intergenic
1125696257 15:41639841-41639863 AACCACATGCTCCTGGGGCCAGG - Intronic
1125723361 15:41855732-41855754 CACCCCCAGCTCCTGGAGGCGGG - Exonic
1126824520 15:52535924-52535946 AACCTCCACCTCCTGGGTCCTGG - Intergenic
1127573890 15:60271762-60271784 AACCTCCCCCTCCCGGGTCCAGG + Intergenic
1128045819 15:64616888-64616910 AACCTCCACCTCCCGGGTTCAGG + Intronic
1128079709 15:64849221-64849243 AACCTCCATCTCCTGGGTCCTGG + Intronic
1128106208 15:65046829-65046851 AACCTCCATCTCCCGGGCACAGG - Intronic
1128771645 15:70287103-70287125 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1128791261 15:70435567-70435589 AGCCCCATGCCCCCGGGGCCAGG + Intergenic
1129150257 15:73684142-73684164 AACCCTCGGCTCCCGGAGCAGGG - Intronic
1129714242 15:77837748-77837770 AACCCCAAGCTCACGATGCCTGG - Intergenic
1130033035 15:80333029-80333051 AATCCCCAGCTCCAAGGTCCTGG - Intergenic
1131000920 15:88939284-88939306 CACCCCCAGCTTCCAGGCCCAGG + Intergenic
1131280948 15:91020797-91020819 AACCTCCACCTCCCGGGTTCAGG - Intronic
1131363024 15:91811959-91811981 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1131514665 15:93069189-93069211 AACCTCCACCTCCCGGGTTCGGG + Intronic
1131956531 15:97742118-97742140 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1132345031 15:101102911-101102933 AAGGCCCAGCTCTAGGGGCCTGG + Intergenic
1132650983 16:1021340-1021362 AACTCCCAGCTCCCGGGCTCAGG - Intergenic
1132750335 16:1454690-1454712 CACCCTCAGCACCCGGGGCGGGG + Intronic
1133816492 16:9201296-9201318 AACCCCCACCTCCCAGGTTCAGG - Intergenic
1134027904 16:10968407-10968429 ATTCCCCAGCTCCCAGCGCCTGG - Intronic
1134355456 16:13477881-13477903 AACCTCCACCTCCCGGGTTCGGG - Intergenic
1134868060 16:17626609-17626631 AACCTCCACCTCCCGGGCTCAGG - Intergenic
1135326658 16:21530345-21530367 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1135542752 16:23344910-23344932 AACCTCCACCTCCCGGGCTCAGG - Intronic
1135679161 16:24442155-24442177 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1135784094 16:25332387-25332409 AACCTCCACCTCCCGGGCTCAGG - Intergenic
1135906177 16:26513904-26513926 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1136250513 16:29001455-29001477 AACCTCCACCTCCCGGGTTCGGG - Intergenic
1136551755 16:30985759-30985781 GACCCGCAGCTCCCCGAGCCGGG - Exonic
1136679469 16:31948367-31948389 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1136791198 16:32969211-32969233 GCCCCCCAGCCCCTGGGGCCTGG - Intergenic
1136878616 16:33884721-33884743 GCCCCCCAGCCCCTGGGGCCTGG + Intergenic
1137446364 16:48534891-48534913 AACCCCCACCTCCCCAGCCCAGG - Intergenic
1137468747 16:48735470-48735492 AACCTCCATCTCCCGGGTTCAGG + Intergenic
1138144361 16:54595529-54595551 AACCCCCAACTCCAGGAGCAGGG + Intergenic
1138549575 16:57740203-57740225 AACTCCCAGCGCCCTGGCCCAGG + Intronic
1138550549 16:57745479-57745501 AACCCCCACCTCCCGGGTTCAGG - Intronic
1138551601 16:57751741-57751763 AGCCCCCAGCCCCTGGGCCCAGG - Intronic
1138573933 16:57894517-57894539 AACCTCCACCTCCCGGGTTCAGG - Intronic
1138834043 16:60411512-60411534 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1139479530 16:67222063-67222085 AACCTCCACCTCCCGGGTTCAGG - Intronic
1139701127 16:68708723-68708745 AACCTCCACCTCCCGGGTTCAGG + Intronic
1139748461 16:69093610-69093632 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1139899983 16:70320627-70320649 AACCACCACCTCCCAGGTCCTGG + Intronic
1140524987 16:75615143-75615165 AATCTCCACCTCCCGGGTCCAGG - Intronic
1141229843 16:82155821-82155843 AACCTCCACCTCCCGGGTTCAGG - Intronic
1141379257 16:83560906-83560928 AACCCTCAGCCCCTGGGGCGGGG - Intronic
1141443912 16:84046032-84046054 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1141490249 16:84368000-84368022 GACCCCCACCTCCAGGGCCCTGG - Intergenic
1141751407 16:85960947-85960969 ACCTCCCAGCTCACGGAGCCAGG - Intergenic
1141807684 16:86352501-86352523 ACCCCCCAGCTCCTGGGTGCAGG - Intergenic
1141958620 16:87390197-87390219 AACCTCCACCTCCCGGGTTCAGG - Intronic
1142048278 16:87940219-87940241 AACGCCCAGCTCCCCGGCCATGG - Intergenic
1142131416 16:88433180-88433202 CAGCTCCAGCTCCCAGGGCCTGG + Exonic
1142193009 16:88726486-88726508 AGCCCCCTGCTCCTGGGCCCTGG - Intronic
1142386253 16:89766631-89766653 AACCTCCACCTCCCGGGTTCAGG - Intronic
1203093407 16_KI270728v1_random:1230673-1230695 GCCCCCCAGCCCCTGGGGCCTGG - Intergenic
1142598485 17:1040993-1041015 AACCTCCACCTCCTGGGTCCTGG + Intronic
1142676665 17:1517450-1517472 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1142724131 17:1799449-1799471 AACCTCCACCTCCCGGGTTCAGG + Intronic
1142730869 17:1856219-1856241 AACCTCCACCTCCCGGGCTCAGG - Intronic
1142749053 17:1976719-1976741 ACCACCCAGCTCACGGGGCAGGG + Intronic
1143232882 17:5372367-5372389 AACCTCCACCTCCCGAGTCCCGG - Intronic
1143666492 17:8364950-8364972 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1144035947 17:11366227-11366249 AACCTCCACCTCCCGGGCTCAGG + Intronic
1144090341 17:11850567-11850589 AACCTCCACCTCCCGGGTTCAGG - Intronic
1144516946 17:15925115-15925137 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1144521491 17:15955486-15955508 AACCTCCATCTCCCGGGCTCAGG + Intronic
1144723720 17:17490358-17490380 AACCTCCACCTCCCGGGTCCCGG - Intronic
1144941541 17:18945506-18945528 AACCTCCACCTCCCGGGCTCAGG - Intergenic
1144962344 17:19051938-19051960 CACCCCCAGCTCCAGGGCCCTGG + Intergenic
1144972817 17:19122582-19122604 CACCCCCAGCTCCAGGGCCCTGG - Intergenic
1145218208 17:21068048-21068070 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1145893842 17:28439831-28439853 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1146053060 17:29567648-29567670 AGCCCCGAGCTCGCGGGGACGGG - Intronic
1146333236 17:31946448-31946470 AACCTCCACCTCCCGGGTTCAGG - Intronic
1146372342 17:32273080-32273102 AACCTCCACCTCCCGGGTTCAGG + Intronic
1147335917 17:39726946-39726968 TGCCCCCAGCGCCCGGGGCAGGG - Exonic
1147607284 17:41781271-41781293 AACCTCCATCTCCCGGGTTCAGG - Intronic
1147694379 17:42340272-42340294 AACCTCCACCTCCCGGGTTCAGG - Intronic
1147734269 17:42624990-42625012 AACCTCCACCTCCTGGGTCCAGG - Intergenic
1148160689 17:45448351-45448373 AACCTCCACCTCCCTGGGGCGGG - Intronic
1148410884 17:47466056-47466078 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1148455338 17:47808267-47808289 AGCCTCCTGCCCCCGGGGCCAGG + Exonic
1148561839 17:48610788-48610810 AACCCCCAGCGCCCGGGCTATGG - Exonic
1148914594 17:50964832-50964854 AACCTCCACCTCCTGGGCCCAGG + Exonic
1148925447 17:51080803-51080825 AACTTCCACCTCCCGGGTCCCGG - Intronic
1149304710 17:55336276-55336298 CACCCCCTGCTCCCCAGGCCAGG + Intergenic
1149500552 17:57149205-57149227 ACCCTCCAGCTGCCGGGGCAGGG + Intergenic
1149538986 17:57454516-57454538 AACCTCCAACTCCCTGGTCCAGG + Intronic
1149610388 17:57954957-57954979 CGCCCCCCGCGCCCGGGGCCCGG + Intronic
1149688805 17:58555893-58555915 AACCACCACCTCCCGGGTTCAGG - Intergenic
1149724688 17:58881578-58881600 AACCTCCACCTCCCGGGTTCAGG - Intronic
1149836168 17:59915068-59915090 AACCTCCACCTCCCGGGTTCAGG + Intronic
1149993133 17:61393799-61393821 CACCCCCTGCTGCTGGGGCCAGG - Intergenic
1150070241 17:62144031-62144053 AACCTCCACCTCCCAGGTCCTGG - Intergenic
1150106940 17:62469180-62469202 AACCTCCACCTCCCGGGTTCAGG - Intronic
1150205022 17:63397191-63397213 AACCTCCACCTCCCGGGTTCAGG - Intronic
1150391976 17:64795216-64795238 AACCTCCACCTCCCTGGGGCAGG - Intergenic
1150432567 17:65130045-65130067 AACCTCCAACTCCCGGGCTCAGG - Intergenic
1150445793 17:65226109-65226131 AACCCCCAGTTCCCTGAGACAGG + Intronic
1150448791 17:65248336-65248358 AACCCTCACCTCCTGGGGTCAGG - Intergenic
1150681045 17:67284772-67284794 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1150695428 17:67401014-67401036 AACCTCCACCTCCCGGGTTCAGG + Intronic
1151139278 17:71976127-71976149 CACCCCCAGCCCCCAGGGCTTGG - Intergenic
1151416677 17:73970847-73970869 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1151441845 17:74134611-74134633 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1151486152 17:74402100-74402122 CACTCCCAGCTCCCCGGTCCTGG + Intergenic
1151562336 17:74877413-74877435 AACCTCCACCTCCCGGGTTCAGG + Exonic
1151628149 17:75290807-75290829 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1151728989 17:75899934-75899956 ACCCACCGGCTCCCGGGGCCTGG - Intronic
1151898007 17:76993391-76993413 AACCTCCACCTCCCAGGTCCTGG + Intergenic
1152130368 17:78472610-78472632 CACACACAGCCCCCGGGGCCAGG - Intronic
1152243393 17:79172090-79172112 AACCTCCACCTCCCGGGTTCAGG - Intronic
1152573639 17:81131003-81131025 AACGCCCAGCACCTGGGCCCCGG + Intronic
1152587381 17:81195127-81195149 CCTCCCCAGCGCCCGGGGCCAGG + Intronic
1152656115 17:81519858-81519880 AACGCCCCGCACCCAGGGCCAGG - Intronic
1152656988 17:81524329-81524351 TACCCCCAGCCCCCTGGTCCAGG - Intergenic
1152872425 17:82763657-82763679 AACCTCCACCTCCCGGGTTCAGG - Intronic
1152926016 17:83088117-83088139 AATCCCAAGGTCCTGGGGCCGGG - Intronic
1153278638 18:3393617-3393639 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1153515412 18:5896224-5896246 GAGCCCCAGCTGCCGGGTCCCGG - Intergenic
1153918390 18:9766207-9766229 AGAGCCCAGCTCCCGGGCCCTGG - Intronic
1155221782 18:23691651-23691673 AACCTCCACCTCCCAGGCCCAGG + Intronic
1155412134 18:25558269-25558291 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1155500268 18:26480683-26480705 AACCTCCATCTCCCGGGTTCAGG - Intronic
1155995309 18:32325032-32325054 AACCTCCACCTCCTGGGTCCTGG + Intronic
1156008582 18:32470977-32470999 CTCCCGCAGCTCCCGCGGCCCGG + Intergenic
1157699091 18:49748685-49748707 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1158593951 18:58800402-58800424 AACCTCCACCTCCCGGGTCCTGG - Intergenic
1159601029 18:70429040-70429062 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1160548615 18:79679258-79679280 ACCCCCAAGCTCCCGCGGCGTGG + Intergenic
1160659331 19:291058-291080 GACCCCCATCCCCCTGGGCCTGG + Exonic
1160812989 19:1020958-1020980 AGCCCGCAGCTCCGGGGCCCGGG - Exonic
1160847802 19:1174060-1174082 AACCCCCAGCCCCGGGCGCAGGG + Intronic
1160852574 19:1200057-1200079 AACCTCCACCTCCCGGGCTCAGG + Intronic
1160853138 19:1204047-1204069 AACCTCCGCCTCCCGGGTCCTGG + Intronic
1160939762 19:1614752-1614774 CACCCCCATTTCCCAGGGCCAGG - Intronic
1161332369 19:3694447-3694469 AGCCACCAGCTCCAGGGCCCAGG + Intronic
1161369600 19:3903321-3903343 AAGCCCCAGATCCCGGGGATGGG + Intronic
1161402904 19:4076655-4076677 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1161445528 19:4316830-4316852 AACCTCCACCTCCCGGGTTCAGG + Intronic
1161569125 19:5020602-5020624 TTCCCCCAGCGCCCGCGGCCTGG - Intronic
1161581430 19:5083002-5083024 GTCCCCCAGCTCCCAGTGCCTGG + Intronic
1162124644 19:8492913-8492935 AACCTCCAGCTCCCAGGTTCCGG - Intronic
1162393635 19:10404077-10404099 AAACCCCAGCTCCCAAGGCAGGG - Intronic
1162722609 19:12671244-12671266 AACCTCCAACTCCCGGGTTCAGG - Exonic
1162749480 19:12819796-12819818 AACCTCCACCTCCCGGGTTCAGG - Intronic
1162811638 19:13167689-13167711 AAGCCCCAGCTGCTGGGCCCCGG - Intergenic
1162818830 19:13210845-13210867 GACGCCCAGCCCCGGGGGCCTGG - Intronic
1163277032 19:16291279-16291301 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1163447494 19:17355608-17355630 AACCTCCACCTCCCAGGTCCTGG + Intronic
1163770612 19:19188914-19188936 AACCTCCACCTCCCGGGTTCAGG + Intronic
1163823793 19:19511560-19511582 AAAACCCAGCTCCTGGGGCCGGG - Intergenic
1163832105 19:19551979-19552001 AACACGCAGCCCACGGGGCCAGG + Intergenic
1164004519 19:21136222-21136244 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1164119192 19:22250498-22250520 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1164666378 19:30041337-30041359 AACCTCCACCTCCTGGGTCCTGG - Intergenic
1164747792 19:30628778-30628800 AACCTCCACCTCCTGGGTCCTGG + Intronic
1164989172 19:32672475-32672497 AAGCCCCAGCTCCCAGGGAGAGG + Intronic
1165005224 19:32799814-32799836 AACCTCCACCTCCCGGGTTCAGG + Intronic
1165112530 19:33510719-33510741 AAGCCCCAGCTCCTAGAGCCAGG - Intronic
1165453423 19:35897968-35897990 GACACCAAGCTCCCGGGACCTGG + Intronic
1165759441 19:38312019-38312041 AACCTCCACCTCCCCGGTCCCGG - Intronic
1165772135 19:38386050-38386072 TACACTCAGCTCCCGGGCCCCGG - Exonic
1165844078 19:38806863-38806885 AACCTCCACCTCCCGGGTTCAGG - Intronic
1166187147 19:41147968-41147990 AACCTCCGCCTCCCGGGTCCTGG - Intergenic
1166317876 19:41998880-41998902 CTCCGCCAGCTCCCGGGGGCCGG + Exonic
1166378924 19:42344446-42344468 AGCCGCCAGCTGCCTGGGCCTGG + Exonic
1166541782 19:43610559-43610581 AAGTCCCAGCTCTCGGGGACAGG - Intronic
1166572425 19:43806066-43806088 GATCCCCAACCCCCGGGGCCTGG + Intronic
1166707914 19:44918739-44918761 AACCTCCACCTCCCGGGTTCAGG + Intronic
1166835565 19:45665742-45665764 AATCTCCACCTCCCGGGTCCTGG - Intergenic
1166877804 19:45908407-45908429 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1167126534 19:47553025-47553047 AACCTCCACCTCCCGGGTTCAGG - Intronic
1167292842 19:48634022-48634044 AACCTCCACCTCCAGGGTCCGGG - Intronic
1167298490 19:48665352-48665374 AACCTCCACCTCCCGGGTTCAGG - Intronic
1167378889 19:49127304-49127326 AGCCTCCACCTCCCGGGTCCCGG - Intronic
1167661314 19:50797584-50797606 AACCGCCACCTCCTGGGTCCAGG - Intergenic
1167697957 19:51026033-51026055 CACCCCAAGCTGCTGGGGCCTGG - Intronic
1167729597 19:51244033-51244055 AGCCCCCAGCTCTTGGGGGCTGG + Intergenic
1167736202 19:51295947-51295969 AACACTCAGCTCCCCGAGCCGGG - Intergenic
1167738752 19:51311852-51311874 CCCCCCCTGCGCCCGGGGCCCGG + Exonic
1167747239 19:51359131-51359153 AACCTCCACCTCCCGGGCTCAGG + Intronic
1167778430 19:51578316-51578338 AACCTCCACCTCCCGGGTTCAGG - Intronic
1168099297 19:54132759-54132781 AACCTCCACCTCCCGGGTCCAGG + Intergenic
1168343400 19:55638921-55638943 AACCTCCAACTCCCGGGCTCAGG - Intronic
1168352975 19:55686996-55687018 AACCGCCAGCGGACGGGGCCAGG - Intronic
1168403049 19:56097102-56097124 AGCCCCCAGCTCCACGGCCCAGG + Intronic
925177629 2:1796549-1796571 ACCCCCCAGCTCCTGGTGCGAGG - Intronic
925218782 2:2121251-2121273 AAACTCCACCTCCCGGGTCCGGG + Intronic
925537185 2:4930344-4930366 AACCTCCACCTCCCGGGTTCAGG - Intergenic
925906501 2:8542917-8542939 AGCCCTTAGCTCCCGAGGCCAGG + Intergenic
927546104 2:23955012-23955034 AACCTCCACCTCCCGGGTTCAGG + Intronic
927597519 2:24409728-24409750 AACCTCCATCTCCCGGGTTCAGG + Intergenic
927651764 2:24917746-24917768 CACCCCGAGCTCCCGGAGGCAGG + Intronic
927758696 2:25730549-25730571 AACCTCCACCTCCCAGGTCCCGG - Intergenic
927776021 2:25903915-25903937 AACCTCCACCTCCCGGGTTCAGG - Intergenic
927902230 2:26828774-26828796 AACCTCCACCTCCCGGGTTCAGG - Intergenic
928036634 2:27830339-27830361 AACCTCCACCTCCCAGGTCCTGG + Intronic
928140135 2:28721358-28721380 AACCTCCACCTCCCGGGCTCAGG - Intergenic
928149090 2:28810524-28810546 CAGCCCCAGCCCCGGGGGCCTGG + Intronic
928319022 2:30268572-30268594 ATCCCCCTGCTCCCAGGCCCAGG - Intronic
928571592 2:32614748-32614770 AACCTCCACCTCCCGGGTTCAGG - Intronic
928697732 2:33867106-33867128 AACCTCCACCTCCCGGGTTCCGG + Intergenic
929535276 2:42779029-42779051 AATCTCCACCTCCCGGGTCCAGG - Intronic
929711023 2:44266758-44266780 AACCTCCACCTCCCGGGTTCAGG - Intergenic
930125332 2:47791926-47791948 AACCGCCACCTCCCGGGTTCAGG + Intronic
930394263 2:50800629-50800651 AACCTCCACCTCCCGGGTTCAGG + Intronic
930660077 2:54044503-54044525 AACCTCCACCTCCCGGGCTCAGG - Intronic
930737418 2:54793795-54793817 AACTCCCACCTCCTGGTGCCTGG + Intronic
931321463 2:61177659-61177681 CAGCCCCGGCTCCCGCGGCCCGG - Exonic
931326261 2:61227627-61227649 AACCCCCACCTCCCAGGTTCAGG - Intronic
931452052 2:62376192-62376214 AACCTCCACCTCCCGGGTTCAGG - Intergenic
931668531 2:64626901-64626923 AACCTCCGCCTCCCGGGTCCTGG - Intergenic
932266298 2:70369873-70369895 AACCTCCACCTCCCGGGTTCAGG + Intergenic
932274156 2:70439270-70439292 AACCTCCACCTCCCGGGTTCAGG + Intergenic
934059130 2:88277891-88277913 AACCTCCACCTCCCGGGTTCAGG - Intergenic
934562373 2:95319989-95320011 AAGCCCCAGCCCTCGGTGCCAGG - Intronic
934644338 2:96049707-96049729 AACCCCCAGGCCCTGGGGCTTGG - Intergenic
934725480 2:96614687-96614709 AACCTCCACCTCCCGGGTTCAGG - Intronic
934837754 2:97605797-97605819 AACCCCCAGGCCCTGGGGCTTGG - Intergenic
935050431 2:99520738-99520760 AACCTCCATCTCCCGGGTTCAGG + Intergenic
935375365 2:102390641-102390663 AACCCCCAGCTGGCCGGGCGCGG + Intronic
935562845 2:104576413-104576435 CACACCCACCTCACGGGGCCAGG + Intergenic
936153764 2:110035521-110035543 CACCTCCTGCTCCCTGGGCCTGG + Intergenic
936169507 2:110156151-110156173 AACCTCCACCTCCCAGGTCCCGG + Intronic
936190921 2:110335894-110335916 CACCTCCTGCTCCCTGGGCCTGG - Intergenic
936803838 2:116300832-116300854 AACCTCCACCTCCCAGGTCCTGG - Intergenic
937115287 2:119400594-119400616 AACCTCCACCTCCCGGGTTCAGG + Intergenic
937167760 2:119836936-119836958 AACCCTCAGCTCCAGCAGCCTGG + Intronic
937832148 2:126435754-126435776 AACCTCCACCTCCCGGGTTCAGG + Intergenic
938004998 2:127781914-127781936 AACCTCCACCTCCCGGGTTCAGG - Intronic
938022810 2:127920082-127920104 AACCTCCACCTCCCGGGCTCAGG + Intergenic
938249445 2:129802766-129802788 CACCCCCAGCTCCAGAGCCCTGG + Intergenic
938251182 2:129816967-129816989 AACCCCCAGCAGCAGGGGGCAGG + Intergenic
938603053 2:132862901-132862923 AACCTCCACCTCCCGGGTTCAGG + Intronic
938910048 2:135877384-135877406 AACCTCCAGCTCCCGGGTCCAGG + Intergenic
939971918 2:148671530-148671552 AACCCCCACCTCCCAGGTTCAGG - Intronic
940305079 2:152216915-152216937 AACCTCCAGCTCCTGGGTTCAGG + Intergenic
942667054 2:178330782-178330804 AACAAACAGCTCCCAGGGCCCGG - Intronic
943761363 2:191613166-191613188 AACCTCCACCTCCCGGGTTCAGG + Intergenic
944688289 2:202136932-202136954 AACCTCCACCTCCCGGGTTCAGG + Intronic
944702892 2:202261373-202261395 AACCTCCACCTCCCGGGTTCAGG - Intergenic
944788222 2:203095852-203095874 AACCTCCACCTCCCGGGTTCAGG + Intronic
944804516 2:203267759-203267781 AACCTCCAGCTCCCGGGTTTGGG - Intronic
945074198 2:206021692-206021714 AACCCTCACCTCCCGGGTTCAGG + Intronic
945891550 2:215436071-215436093 AAGCCCCGGCTCCCGGCGCTCGG - Exonic
946149843 2:217756804-217756826 CACCCCCAGGCCCTGGGGCCAGG + Intergenic
946201875 2:218075365-218075387 AACACCCAGCACCCAGGGACAGG + Exonic
946396237 2:219445005-219445027 CACCCCCAGGTGCCGTGGCCCGG - Exonic
946431772 2:219630153-219630175 CTCCCCCAGCCCCCGGGCCCGGG + Exonic
946925806 2:224625707-224625729 AACCTCCACCTCCCGGGTCCCGG + Intergenic
947796118 2:232895029-232895051 AATCGCCTGCTCCTGGGGCCTGG + Intronic
947844821 2:233235699-233235721 AACCCCCATCTCCTGGGTTCAGG - Intronic
947915337 2:233828801-233828823 CACCCTCAGCTCCCGGGACCTGG - Intronic
948004131 2:234593414-234593436 AACCTCCACCTCCCGGGTTCAGG + Intergenic
948057993 2:235023463-235023485 AACCCCCACCACCCGGGTTCAGG - Intronic
948447298 2:238042892-238042914 AATCCCCACCTCTCAGGGCCTGG + Intronic
948850685 2:240703937-240703959 AACCCTCAGCTCCCTGGGATGGG + Intergenic
948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG + Intergenic
1168776112 20:448923-448945 AACCTCCGCCTCCCGGGTCCCGG + Intronic
1169238546 20:3953836-3953858 AACCTCCACCTCCCGGGTTCAGG + Intronic
1169266732 20:4171687-4171709 AACCCCCAGCTCCCTGCACCTGG - Intronic
1170551623 20:17481853-17481875 AAATCCCAGCTCCAGGGTCCAGG - Exonic
1170999462 20:21397527-21397549 AAACCCCAGATCCCGCAGCCCGG - Exonic
1171460941 20:25297575-25297597 CACCCCCACCTCCCAGTGCCAGG - Exonic
1172115360 20:32570462-32570484 AGCCCCCATCTTCTGGGGCCTGG + Intronic
1172166838 20:32904706-32904728 AACCTCCACCTCCCAGGTCCAGG + Intronic
1172294644 20:33800176-33800198 AACCTCCGCCTCCCGGGTCCCGG - Intergenic
1172419568 20:34803914-34803936 AACCTCCACCTCCCGGGTTCAGG - Intronic
1172486463 20:35301013-35301035 AACCCCCACCTCCTGGGCTCAGG + Intergenic
1172704219 20:36871417-36871439 AACCCCCACCTCCTGGGTTCAGG + Intergenic
1172706679 20:36887298-36887320 AACCCCAAGATCCCTGAGCCCGG + Intronic
1173202496 20:40964411-40964433 AACCTCCACCTCCCGGGTTCTGG + Intergenic
1173625936 20:44473150-44473172 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1174101234 20:48127569-48127591 AACCCCCATCTCCTGAGTCCAGG + Intergenic
1174224701 20:48987867-48987889 AACCTCCACCTCCCGGGTTCAGG + Intronic
1174553160 20:51375828-51375850 CACCCTCAGCTCTCTGGGCCTGG - Intergenic
1174651939 20:52133945-52133967 AACCTCCACCTCCCGGGCTCAGG - Intronic
1174795822 20:53521888-53521910 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1174823215 20:53745253-53745275 AACCTCCACCTCCCGGGTCCCGG - Intergenic
1174987829 20:55475079-55475101 AACCTCCAACTCCCGGGTTCAGG - Intergenic
1175214354 20:57383434-57383456 AAGCCCCAGACCCCAGGGCCTGG + Intergenic
1175599617 20:60262589-60262611 AACCTCCACCTCCTGGGTCCCGG - Intergenic
1175887613 20:62301722-62301744 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1175928594 20:62482677-62482699 CTCCCCCAGCTGCCTGGGCCAGG - Intergenic
1177441633 21:21134148-21134170 AACCTCCGCCTCCCGGGTCCAGG + Intronic
1178066681 21:28912182-28912204 AACCTCCACCTACCGGGGTCGGG + Intergenic
1178425000 21:32472238-32472260 AACCTCCACCTCCCGGGTTCAGG + Intronic
1179215751 21:39366056-39366078 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1179411635 21:41167687-41167709 ACCCCCAAGCGCGCGGGGCCGGG + Intergenic
1179684130 21:43044105-43044127 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1179889875 21:44330124-44330146 ACCCTCCAGCTCCCGGGGGCTGG + Exonic
1179922882 21:44516643-44516665 AGCCCCCAGAGCCAGGGGCCGGG + Intronic
1180146332 21:45921735-45921757 AACCTCCACCTCCCGGGCTCAGG - Intronic
1180649465 22:17366849-17366871 ACCCCTCAGCTCCTGGGGCCAGG + Intronic
1180727684 22:17958783-17958805 AACCTCCACCTCCCGGGTTCAGG + Intronic
1180856733 22:19051642-19051664 AACCTCCAGCTCCCGGGCTCAGG - Intronic
1180875243 22:19172034-19172056 CACCCCCTCCTCTCGGGGCCCGG - Intergenic
1181032228 22:20154217-20154239 AACCTCCAGCAGCCAGGGCCAGG - Intergenic
1181058696 22:20271801-20271823 ACCCCCCAGCTCCCTGGCACTGG - Intronic
1181590234 22:23879706-23879728 AACCCAGAGCTCCTGGGCCCAGG + Intronic
1181723122 22:24791291-24791313 AACCTCCATCTCCTGGGTCCTGG - Intergenic
1182001722 22:26925470-26925492 TACCCCTAGGTTCCGGGGCCAGG - Intergenic
1182005475 22:26956020-26956042 AACCTCCAGCTCCCAGGTTCAGG - Intergenic
1182102855 22:27670110-27670132 AACCCACAGCCTCTGGGGCCAGG - Intergenic
1182463360 22:30498202-30498224 AACCTCCACCTCCCAGGTCCAGG + Intronic
1182669447 22:31983664-31983686 AACCTCCATCTCCCGGGGCAAGG - Intergenic
1182700636 22:32234615-32234637 AACCTCCACCTCCCGGGTTCAGG - Intronic
1182825917 22:33264575-33264597 AACCTCCACCTCCCGGGTTCAGG - Intronic
1182860552 22:33555846-33555868 AACCTCCACCTCCCGGGCTCAGG - Intronic
1182930811 22:34172578-34172600 AACCTCCACCTCCCAGGTCCCGG - Intergenic
1183106249 22:35617307-35617329 AAACCCCAGCTGTTGGGGCCAGG - Exonic
1183344532 22:37299907-37299929 AACCTCCACCTCCCAGGTCCAGG - Intronic
1183524738 22:38316714-38316736 AACCCCCAGGTCCGGGCGCCGGG + Intronic
1183691349 22:39390395-39390417 AACCTCCACCTCCCGGGTCCAGG - Intergenic
1183749769 22:39713206-39713228 AATCCCCAGCACCTGGGGCCTGG + Intergenic
1183798476 22:40141285-40141307 AACCTCCACCTCCCGGGTTCAGG + Intronic
1183891176 22:40930209-40930231 AACCTCCATCTCCCGGGTTCAGG + Exonic
1184272379 22:43392209-43392231 AACCTCCGCCTCCCGGGTCCAGG - Intergenic
1184324896 22:43775522-43775544 AACCTCCACCTCCTGGGTCCAGG + Intronic
1184360277 22:44012976-44012998 AACCTCCACCTCCCGGGTTCAGG + Intronic
1184735997 22:46398166-46398188 AACCCCTGGCTCCAGGGGACAGG + Intronic
1184832135 22:46995652-46995674 AACCCCCAGCTCCAGAACCCAGG - Intronic
1185175213 22:49322535-49322557 GACCCCCAGCCTCGGGGGCCTGG + Intergenic
1185179546 22:49351225-49351247 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1185388970 22:50548763-50548785 GAAGCCCAGCTCCCGGGCCCTGG + Exonic
949919349 3:8988972-8988994 CACCCCCAGCCCCCGGGCCATGG - Intronic
950011251 3:9725451-9725473 AACCTCCACCTCCCGGGCTCAGG - Intronic
950115789 3:10449672-10449694 CACCCCCACCCCCCGGGACCCGG - Exonic
950488229 3:13285361-13285383 AACCTCCAGCTCCGGGGAGCTGG - Intergenic
950510055 3:13420468-13420490 CTCCCTCAGCTCCGGGGGCCCGG - Intergenic
950609765 3:14118578-14118600 AACCCTCAGCACACGGGGCCAGG + Intronic
950696117 3:14702520-14702542 AACCTCCACCTCCCGGGTTCAGG + Intronic
950704756 3:14772908-14772930 AAGCCCCAGCACCCCGGGCCGGG - Exonic
951544785 3:23813622-23813644 AACCTCCACCTCCCGGGTCCTGG + Intronic
951779844 3:26350154-26350176 AACCTCCATCTCCCGGGTTCAGG + Intergenic
952206509 3:31185791-31185813 AACTCCCAGCTCCTGGTGCATGG + Intergenic
952365293 3:32669210-32669232 AACCCCCACCTCCTGGGTTCAGG + Intergenic
953688137 3:45094305-45094327 AACCTCCACCTCCCGGGTTCAGG + Intronic
953884514 3:46707778-46707800 AGCCCCAGCCTCCCGGGGCCTGG + Intronic
954110077 3:48428944-48428966 AACCCCCAGACCCCGAGGCGAGG + Intronic
954136092 3:48582852-48582874 AACCCTCAGCCCCAGGGACCTGG - Intronic
954379009 3:50209783-50209805 AGCCCCCAGCTCCCTGGCCTTGG - Intronic
954609937 3:51939037-51939059 TACCCCCAGCTCCCAGGAGCAGG - Intronic
954800784 3:53185858-53185880 AACTCCCCTCCCCCGGGGCCTGG - Intronic
955368155 3:58328875-58328897 AACCTCCACCTCCCGGGTTCAGG - Intergenic
956088090 3:65635144-65635166 AACCTCCACCTCCCAGGTCCAGG + Intronic
956270994 3:67446510-67446532 AACCTCCACCTCCCGGGTTCAGG + Intronic
956372154 3:68574426-68574448 AACCTCCACCTCCCAGGTCCTGG - Intergenic
956383027 3:68686076-68686098 AACTCCCATCTCCCTGGGACAGG - Intergenic
956518059 3:70072443-70072465 AAACTCCAGCTCACGGGGCGGGG - Intergenic
956644149 3:71439862-71439884 AACCCCCATCTCCTGGGTTCAGG - Intronic
956712900 3:72053904-72053926 AACCTCCACCTCCCGGGTTCAGG + Intergenic
959035992 3:101365082-101365104 AACCTCCACCTCCCGGGCTCAGG + Intronic
959530700 3:107431434-107431456 AACCCAGAGCGCCCGGGCCCAGG - Intergenic
959667307 3:108936178-108936200 AACCTCCAACTCCCGGGCTCAGG - Intronic
959692302 3:109211129-109211151 AACCTCCACCTCCCGGGTTCAGG + Intergenic
960142247 3:114162448-114162470 CACCCCCAGCTCCCAGAGCAGGG + Intronic
960682957 3:120267862-120267884 AACCTCCACCTCCCGGGTCCAGG - Intronic
960884852 3:122383595-122383617 ACCCCCCTGCTCCAGGGTCCGGG - Intergenic
960975811 3:123172643-123172665 AACCTCCACCTCCCGGGTTCAGG - Intronic
961322207 3:126083948-126083970 AGCCCCCAGGGCCCGGCGCCCGG + Intronic
963155157 3:142088410-142088432 AACCTCCACCTCCCGGGTTCAGG + Intronic
963664361 3:148163800-148163822 AACCCCCACCTCGCGGGTTCAGG - Intergenic
963742728 3:149096666-149096688 AACCTCCACCTCCCGGGTTCAGG - Intergenic
964677068 3:159295345-159295367 AACCTCCACCTCCCGGGTTCAGG - Intronic
966180229 3:177181396-177181418 AACCTCCACCTCCCGGGTTCAGG - Intronic
966430769 3:179829856-179829878 AACCTCCACCTCCCGGGTTCAGG + Intronic
966749568 3:183309323-183309345 AACCCCCAGCCCCCTAGTCCAGG + Intronic
966871761 3:184294726-184294748 AACCTCCACCTCCCAGGTCCCGG - Intronic
966879213 3:184340400-184340422 AACCTCCGCCTCCCGGGTCCTGG + Intronic
967179372 3:186890061-186890083 AACCTCCACCTCCCGGGTTCAGG + Intergenic
967240235 3:187431298-187431320 AACACCCAGCGCCCGGGAACAGG - Intergenic
967918259 3:194595705-194595727 AACCTCCGCCTCCCGGGTCCAGG + Intronic
968154526 3:196368902-196368924 AACCTCCACCTCCCGGGTTCAGG + Intronic
968485506 4:859116-859138 AAGCCACAGCGCCCGGGGCCGGG + Intronic
968670286 4:1846340-1846362 AACTGCCACCTCCCGGGTCCCGG + Intronic
968720696 4:2201183-2201205 AACCTCCACCTCCCGGGTTCAGG - Intronic
968963651 4:3758400-3758422 CACCCTCAGCTCCTGTGGCCAGG + Intergenic
970847218 4:20554843-20554865 AACCTCCACCTCCCGGGTCCCGG + Intronic
971304671 4:25469334-25469356 AACCTCCACCTCCCGGGTTCAGG + Intergenic
971430029 4:26556143-26556165 AACTCCCATCTCCCTGGGACTGG - Intergenic
972297324 4:37752656-37752678 AACCTCCAACTCCCGGGTTCAGG + Intergenic
972298852 4:37766443-37766465 AACCTCCACCTCCTGGGTCCAGG + Intergenic
972459965 4:39292721-39292743 AACCTCCACCTCCCGGGTTCAGG + Intronic
972471021 4:39404736-39404758 AACCTCCACCTCCCGGGATCAGG + Intergenic
972485104 4:39533398-39533420 AACCTCCACCTCCCGGGTCCAGG - Intergenic
972533136 4:39977846-39977868 AGGCCCCGGCTCCCGGGGCACGG - Exonic
973202257 4:47517332-47517354 AACCTCCACCTCCCGGGCTCAGG - Intronic
973291358 4:48474100-48474122 AACCTCCACCTCCCGGGTTCAGG + Intergenic
973812153 4:54581777-54581799 AACCCCCACCTCCCAGGTTCAGG - Intergenic
973954269 4:56048089-56048111 AACCTCCAACTCCCGGGTTCAGG - Intergenic
976737105 4:88321374-88321396 AACCTCCACCTCCCGGGTTCAGG + Intergenic
977155405 4:93566686-93566708 AACCCCCATCTCCTGGGTTCAGG - Intronic
977248294 4:94659976-94659998 AACCTCCACCTCCCGGGTTCAGG + Intronic
978189455 4:105895533-105895555 AACCCCCAGCCCTCGCCGCCCGG - Exonic
978609802 4:110525280-110525302 ACATCCCAGCTCCTGGGGCCAGG - Intronic
979870213 4:125809844-125809866 AACCTCCACCTCCCGGGTCTTGG - Intergenic
980143300 4:128948252-128948274 AACCTCCACCTCCCGGGTTCAGG - Intronic
980827279 4:138088620-138088642 CGCCCCCTGCTCCCGGCGCCCGG - Intergenic
981177529 4:141699998-141700020 AATCCCCATCTCCCGGGTTCAGG + Intronic
982088876 4:151863201-151863223 AACCTCCACCTCCCGGGTTCAGG - Intergenic
982402058 4:154978991-154979013 AACCTCCACCTCCCGAGTCCTGG + Intergenic
982470001 4:155776586-155776608 AACCTCCACCTCCCGGGTTCAGG - Intronic
983525649 4:168757987-168758009 AACCTCCAGCTCCCAGGTTCAGG - Intronic
984984280 4:185312602-185312624 AACCTCCACCTCCCGGGTTCAGG + Intronic
985274938 4:188229191-188229213 AACCTCCACCTCCCGGGTTCAGG + Intergenic
985663492 5:1169327-1169349 CATCCCCAGCTCCAGGGCCCAGG + Intergenic
985733641 5:1565174-1565196 GACCCCCAGCTACCGGCTCCAGG - Intergenic
985778307 5:1856896-1856918 ACGCCCCCGCTCCCAGGGCCGGG + Intergenic
985842391 5:2317913-2317935 AACCCACAGCAGCCAGGGCCAGG - Intergenic
986245429 5:6002629-6002651 AACCTCCACCTCCCGGGTTCAGG + Intergenic
986305786 5:6515020-6515042 AAACTCCAGCTCCCTGTGCCAGG + Intergenic
986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG + Intergenic
986346532 5:6840560-6840582 AACCTCCAGCTCCCAGGACCAGG - Intergenic
986643396 5:9893284-9893306 AACCTCCACCTCCCGTGGCCGGG + Intergenic
986753229 5:10809803-10809825 AACCTCCACCTCCCGGGTTCAGG + Intergenic
987215628 5:15734030-15734052 ACCCTCCATCTCCCGGGTCCCGG - Intronic
987303483 5:16617186-16617208 ACCGCCCAGCTCCCGGCGCCCGG - Intergenic
987525817 5:19047591-19047613 AACCCCCAGCTCTTAGAGCCAGG - Intergenic
988044488 5:25932366-25932388 AACCTCCACCTCCTGGGTCCTGG - Intergenic
988588562 5:32529071-32529093 AACCTCCACCTCCCAGGTCCCGG - Intergenic
989385739 5:40853275-40853297 AATCCCCAGCTCCCTGGCCAGGG - Exonic
989593194 5:43130943-43130965 AACCTCCATCTCCCGGGTTCAGG + Intronic
990473770 5:56142250-56142272 AACCTCCACCTCCCGGGTCCTGG - Intronic
990829603 5:59941788-59941810 AACCCCCACCTCAGGAGGCCAGG + Intronic
990903819 5:60781126-60781148 AACCTCCACCTCCCGGGTTCAGG - Intronic
991083270 5:62624114-62624136 AACCTCCACCTCCCGGGTTCAGG + Intronic
991245673 5:64506344-64506366 AGCGCCCAGCTCCCGGGACAGGG + Exonic
991407854 5:66319476-66319498 ATGCCCCAGCTCCAGGTGCCTGG - Intergenic
991694651 5:69258992-69259014 AACCCCCACCTCCTGGGCTCAGG - Intronic
991902241 5:71472377-71472399 AACCTCCACCTCCCGGGTTCAGG - Intronic
992471473 5:77059921-77059943 AACCTCCATCTCCCGGGTTCAGG + Intronic
992534506 5:77685225-77685247 AACCTCCGCCTCCCGGGTCCTGG - Intergenic
992561616 5:77958093-77958115 AACCCCCACCTCGGGCGGCCGGG + Intergenic
994196097 5:96924677-96924699 AACCTCCACCTCCCGGGTTCAGG + Intronic
997458041 5:134032039-134032061 AACCTCCACCTCCCGGGTTCAGG - Intergenic
998090047 5:139360572-139360594 AACCTCCACCTCCCAGGGTCAGG + Intronic
998118369 5:139556324-139556346 AACCTCCACCTCCCGGGTTCAGG - Intronic
998381186 5:141726833-141726855 AACCTCCACCTCCCGGGTTCAGG + Intergenic
998456193 5:142275339-142275361 AACCTCCAACTCCCGGGTTCAGG - Intergenic
998931456 5:147186049-147186071 AACCTCCAACTCCCGGGTTCAGG + Intergenic
999144958 5:149386272-149386294 AGCCCCAAGCTCCCTGAGCCAGG - Intronic
999157708 5:149470291-149470313 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1000540513 5:162533304-162533326 AACCTCCACCTCCCGGGTCCTGG - Intergenic
1000553954 5:162700639-162700661 AACCTCCATCTCCCGGGTTCAGG - Intergenic
1001063642 5:168517222-168517244 AACCTCCACCTCCCGGGTTCAGG + Intronic
1001476398 5:172054109-172054131 AAGTACCAGCTCCTGGGGCCAGG + Intronic
1001486922 5:172126480-172126502 AACCTCCACCTCCCGGGTTCAGG - Intronic
1002086203 5:176777135-176777157 CACCCCATGCTCCTGGGGCCAGG + Intergenic
1002499149 5:179635893-179635915 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1002502527 5:179656630-179656652 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1002515301 5:179753742-179753764 AACCTCCGCCTCCCGGGCCCGGG + Intronic
1002795125 6:465766-465788 AACATCCAGCTCCCGGAGCCCGG + Intergenic
1003041663 6:2693837-2693859 AACCTCCAACTCCCGGGTTCAGG + Intronic
1003631347 6:7790434-7790456 AACCTCCACCTCCAGGGCCCAGG - Intronic
1004458883 6:15817236-15817258 AAACATCAGCTCCTGGGGCCTGG + Intergenic
1004490088 6:16106706-16106728 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1004705613 6:18121739-18121761 AAACCCCAGTCCCCAGGGCCAGG + Exonic
1004723453 6:18289254-18289276 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1005040554 6:21596155-21596177 ATCCCCCACCTTCCCGGGCCGGG + Exonic
1005061759 6:21783053-21783075 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1005139657 6:22613871-22613893 AACCTCCAGCTCCCGGAGGATGG + Intergenic
1006334236 6:33412078-33412100 AACCTCCACCTCCCGGGTTCAGG - Intronic
1006359361 6:33578878-33578900 CACCCCCACCGCCCAGGGCCTGG + Intronic
1006426097 6:33963805-33963827 AACCCCCAGCACCTGGCACCGGG + Intergenic
1006430925 6:33995218-33995240 AACCAGCACCTCCCAGGGCCCGG - Intergenic
1006490356 6:34381989-34382011 AACCCCCGTCTCCCGGGTTCAGG - Intronic
1006546072 6:34782603-34782625 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1006629483 6:35420906-35420928 AACCTCCACCTCCCGGGTTCAGG + Intronic
1006692853 6:35904721-35904743 AACCTCCACCTCCCGGGTCCTGG - Intronic
1006703757 6:35998974-35998996 AACCTCCACCTCCCGGGTTCAGG + Intronic
1007090629 6:39182625-39182647 AACCACCAGCTCCCGTGAGCTGG + Intergenic
1007493268 6:42240972-42240994 AACCTCCACCTCCCGGGTTCAGG + Intronic
1007561774 6:42815269-42815291 AACCCCCATCTCCTGGGATCAGG + Intronic
1007633052 6:43283420-43283442 GAGCCCAAGCCCCCGGGGCCTGG + Exonic
1007660791 6:43484805-43484827 AACCTCCACCTCCCGGGTTCAGG + Intronic
1007773307 6:44208470-44208492 TACCCCCAACTCCCTGGCCCTGG + Intergenic
1007792788 6:44322012-44322034 AACCTCCACCTCCCGGGATCAGG - Intronic
1007805827 6:44445179-44445201 ATCCCTCAGCTCCCAGAGCCAGG + Intronic
1008785146 6:55158823-55158845 AACTCCCATCTCCCTGGGACAGG + Intronic
1010415338 6:75604989-75605011 AACCTCCAGCTCCTGGGTTCAGG - Intronic
1011705037 6:89992558-89992580 AACCTCCACCTCCCGGGTTCAGG - Intronic
1012564463 6:100629977-100629999 AACCTCCACCTCCCGGGTTCAGG + Intronic
1012762629 6:103321140-103321162 AACCTCCGCCTCCCGGGTCCAGG - Intergenic
1012982793 6:105847469-105847491 AACCTCCACCTCCCAGGTCCAGG - Intergenic
1013312426 6:108908330-108908352 AGCCCCCAGCTGGAGGGGCCTGG - Intronic
1013354905 6:109337969-109337991 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1014237081 6:118970083-118970105 AACCTCCACCTCCCGGGTCCAGG + Intronic
1014699348 6:124664191-124664213 AACCTCCGCCTCCCGGGTCCAGG - Intronic
1014971358 6:127819036-127819058 AACCTCCACCTCCCGGGTTCAGG - Intronic
1016035056 6:139375586-139375608 CACCCCCACCTCCCGGATCCAGG - Intergenic
1016419092 6:143865895-143865917 AACCTCCAACTCCCGGGTTCAGG + Intronic
1016969340 6:149748235-149748257 AACCTCCACCTCCCAGGTCCCGG - Intronic
1017016097 6:150100697-150100719 CACCCCCAGCTTCCAGGCCCCGG - Intergenic
1017125477 6:151060508-151060530 AGCCCCCTGCTCCAGGAGCCAGG + Intronic
1017142004 6:151199440-151199462 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1017170184 6:151449285-151449307 AACCTCCACCTCCCGGGTTCAGG - Intronic
1017421863 6:154281269-154281291 AACCTCCACCTCCCGGGTTCAGG - Intronic
1018099097 6:160420639-160420661 AACTCCCAACTCCCCGGCCCTGG - Intronic
1018662384 6:166100247-166100269 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1018745346 6:166757583-166757605 ACTCCCCAGGTCCCGGGGGCCGG + Intronic
1018794052 6:167172201-167172223 CAGCCCCAGCTCCCGGGCACGGG - Exonic
1018822283 6:167382876-167382898 CAGCCCCAGCTCCCGGGCACGGG + Exonic
1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG + Intergenic
1019266430 7:119813-119835 AAGACCCAGCTCCCATGGCCTGG - Intergenic
1019340359 7:506092-506114 AACCTCCACCTCCCGGGTTCAGG - Intronic
1019373857 7:678185-678207 AACCTCCACCTCCCGGGTTCAGG - Intronic
1019424974 7:970522-970544 AACCTCCACCTCCCGGGTTCAGG + Intronic
1019442884 7:1056271-1056293 CACCCCCAGGTCCTGGGTCCAGG - Intronic
1019455072 7:1122746-1122768 AAACCCCAGCTCCCCGGGGAGGG + Intronic
1019500663 7:1362929-1362951 AACCTCCACCTCCCGGGTTCGGG - Intergenic
1019775820 7:2911614-2911636 CTCCCCCAGCTGCCGGGGGCTGG - Intronic
1019858654 7:3635786-3635808 AACCTCCACCTCCCGGGGTCAGG + Intronic
1019870848 7:3759671-3759693 AACCTCCACCTCCCGGGTTCAGG + Intronic
1020015021 7:4825798-4825820 AACTTCCACCTCCCGGGTCCTGG - Intronic
1020401011 7:7777422-7777444 AACCACCACCTCCCGGGTTCAGG - Intronic
1021658874 7:22898682-22898704 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1021881694 7:25101177-25101199 AACCTCCACCTCCCGGGTCCAGG - Intergenic
1022167338 7:27781798-27781820 AACCTCCAGCTCCTGGGTTCAGG + Intronic
1023035656 7:36129299-36129321 AAGACCTGGCTCCCGGGGCCCGG - Intergenic
1023061028 7:36327218-36327240 AACCTCCACCTCCCGGGTTCAGG + Intronic
1023537359 7:41227662-41227684 AACCTCCACCTCCCGGGTCCCGG + Intergenic
1023857151 7:44191300-44191322 AACCACCATCTCCCAGGACCCGG - Intronic
1024896233 7:54265448-54265470 AACCCTCAGCTTCCAGGGACTGG - Intergenic
1025267630 7:57477572-57477594 AACCTCCAGCTCCTGGGTTCAGG - Intergenic
1025916682 7:65872392-65872414 AACCTCCACCTCCCGGGTTCCGG + Intergenic
1026148599 7:67769469-67769491 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1026742118 7:72985316-72985338 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1026801962 7:73405740-73405762 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1027028240 7:74870063-74870085 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1027101617 7:75379761-75379783 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1027243070 7:76345857-76345879 AACCTCCATCTCCCGGGTCCCGG - Intronic
1027253023 7:76410911-76410933 AACCTCCACCTCCCGGGTTCAGG - Intronic
1027379301 7:77588952-77588974 AACCTCCATCTCCCGGGTTCAGG + Intronic
1028919502 7:96295265-96295287 AACCTCCACCTCCCGGGTTCAGG - Intronic
1029482380 7:100821043-100821065 AACCTCCACCTCCCGGGTTCAGG - Intronic
1031143656 7:117973487-117973509 AACCTCCACCTCCCGGGTCTGGG - Intergenic
1031361478 7:120853790-120853812 AACCTCCACCTCCCGGGTTCAGG - Intronic
1031511909 7:122660826-122660848 AACCTCCACCTCCCGGGTTCAGG - Intronic
1031757097 7:125658742-125658764 AACCCCCATCTCCCTGTCCCTGG + Intergenic
1032058722 7:128705744-128705766 AACCTCCACCTCCCGGGCTCAGG + Intergenic
1032118050 7:129134138-129134160 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1032198999 7:129805855-129805877 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1032285779 7:130537535-130537557 AGCTCCCAGCTCCTGGGCCCAGG - Intronic
1032286542 7:130541961-130541983 AGCTCCCAGCTCCTGGGCCCAGG - Intronic
1032659708 7:133969966-133969988 AACTCCCATCTCCCTGGGACAGG - Intronic
1033162264 7:139008260-139008282 AACCTCCATCTCCCGGGTTCAGG + Intergenic
1033411874 7:141125596-141125618 AACCCCCACCTCCTGGGTTCAGG - Intronic
1033466096 7:141591172-141591194 AACCTCCACCTCCCGGGTTCAGG + Intronic
1033665049 7:143432886-143432908 AACCTCCACCTCCCGGGTTCCGG + Intergenic
1034334969 7:150316113-150316135 AACCTCCACCTCCCGGGTTCAGG - Intronic
1035118292 7:156543515-156543537 AGCCTCCACCTCCCGGGTCCAGG - Intergenic
1035177373 7:157061374-157061396 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1035266396 7:157692288-157692310 ACCCCCCACCTCCCCAGGCCAGG + Intronic
1035754874 8:2023546-2023568 AACCTCCAGCTCCCGAGGTCAGG - Intergenic
1035755323 8:2026732-2026754 GACCCCCAGCCCCCGGAGCAGGG - Intergenic
1037337105 8:17801733-17801755 ATCCCCCACCTACCGCGGCCCGG - Intergenic
1037356788 8:18029067-18029089 AACCTCCACCTCCCGGGTTCAGG - Intronic
1037407053 8:18554137-18554159 ACCCCCCACCTCCTGGGGACAGG + Intronic
1037813677 8:22101095-22101117 AACCTCCACCTCCCGGGTTCCGG + Intronic
1037847840 8:22300019-22300041 AACCTCCATCTCCCGGGTTCAGG + Intronic
1038048209 8:23785150-23785172 AACCTCCATCTCCCGGGTTCAGG + Intergenic
1038328688 8:26591033-26591055 AACTGCCAGCTCCCAGGGCCAGG - Intronic
1038395019 8:27240253-27240275 AACACTCACCTCCCTGGGCCTGG + Intronic
1038577047 8:28713986-28714008 AACCTCCACCTCCCGGGTTCAGG + Intronic
1038658335 8:29474593-29474615 AACCCACAGCTCCCGACCCCAGG - Intergenic
1039800469 8:40950245-40950267 GCCCCCCATCTCCCTGGGCCAGG + Intergenic
1040032314 8:42836310-42836332 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1040444745 8:47482351-47482373 AACCTCCAGCTCCCGGGCTCAGG - Intronic
1040550977 8:48437427-48437449 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1041031309 8:53738213-53738235 AACCTCCACCTCCCGGGTTCAGG - Intronic
1041111776 8:54489605-54489627 AACCTCCAGCTCCCAGGTTCAGG + Intergenic
1042141828 8:65686840-65686862 AACCTCCAGTTCCCGGGTTCAGG - Intronic
1042342960 8:67699332-67699354 AACCTCCACCTCCCGGGTTCAGG - Intronic
1043390595 8:79787782-79787804 AACCTCCACCTCCCGGGCTCAGG + Intergenic
1044070750 8:87756778-87756800 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1044709109 8:95038462-95038484 TAGCCCCAGCTACCCGGGCCTGG - Intronic
1044820595 8:96153487-96153509 ACCCCCCAGGTCCCGGCCCCAGG - Intronic
1044871890 8:96627933-96627955 AACCTCCACCTCCCAGGCCCAGG + Intergenic
1045233481 8:100328551-100328573 AACCTCCACCTCCCGGGTTCAGG + Intronic
1045297858 8:100888039-100888061 AACCCCCAGCACTCAGGGCAAGG + Intergenic
1046105994 8:109667196-109667218 AACCTCCACCTCCCGGGTTCAGG + Intronic
1047002896 8:120590760-120590782 AACCTCCACCTCCTGGGTCCCGG + Intronic
1047818104 8:128487299-128487321 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1048965466 8:139611476-139611498 AACCCCCAGCCTCTGTGGCCTGG - Intronic
1049199115 8:141331290-141331312 AAAACCCAGCTCCCAGGGGCTGG - Intergenic
1049329724 8:142043746-142043768 ACACCCCGGCTCCCGGGGCTTGG - Intergenic
1049683614 8:143930596-143930618 CACCCCCAGACCCCGGGACCAGG + Intronic
1050197763 9:3106240-3106262 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1051170595 9:14315447-14315469 AATCCCCACCCCCCGGGGCCCGG + Intronic
1051195178 9:14556330-14556352 AACCTCGACCTCCCGGGCCCGGG + Intergenic
1051443546 9:17114659-17114681 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1051863354 9:21651475-21651497 AACTCCCATCTCCCTGGGACAGG - Intergenic
1052588549 9:30460559-30460581 AACCTCCAGCTCCTGGGTTCAGG - Intergenic
1052954563 9:34243565-34243587 AACCTCCACCTCCCAGGGTCGGG + Intronic
1052987035 9:34495291-34495313 AACCTGCATCTCCCAGGGCCAGG + Intronic
1053018597 9:34678710-34678732 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1054967399 9:71045176-71045198 AACCTCCACCTCCTGGGTCCAGG + Intronic
1056149817 9:83774789-83774811 AACCTCCACCTCCCGGGTTCAGG + Intronic
1056370417 9:85948837-85948859 AACCTCCATCTCCCGGGTTCAGG + Intronic
1057695293 9:97318691-97318713 AACTCCCAGCTCTCTGGCCCTGG + Intronic
1057695368 9:97319102-97319124 AACTCCCAGCTCTCTGGCCCTGG - Intronic
1058055155 9:100441555-100441577 AACCTCCACCTCCCGGGTTCAGG - Intronic
1058997709 9:110315977-110315999 AACCTCCGCCTCCCGGGTCCAGG + Intronic
1059175861 9:112169754-112169776 AACCTCCACCTCCCGGGTTCAGG + Intronic
1059427597 9:114230984-114231006 ATCCCCAAGGTCCCTGGGCCTGG - Intronic
1059459957 9:114423398-114423420 AGCCCCCAGGCCCCGGGGCTGGG - Exonic
1060608248 9:124937369-124937391 AACCTCCATCTCCCGGGTTCAGG - Intronic
1060670814 9:125467703-125467725 TGCCCCCAGCTCCCGGGGCTGGG + Intronic
1060968505 9:127724707-127724729 GACCCCCAACTCCCAGTGCCCGG - Intronic
1061071550 9:128313946-128313968 CACCCCCAGCTTCTGGGGCAGGG - Intronic
1061149984 9:128823067-128823089 AACGCCCACCTCCCAGGGCCAGG + Intronic
1061223155 9:129264220-129264242 AACCTCCACCTCCCGGGTTCCGG + Intergenic
1061258673 9:129467327-129467349 AACCCCCACCACCCAGGGCAAGG - Intergenic
1061270563 9:129538720-129538742 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1061791824 9:133063136-133063158 AACCTCCCGGTCCCAGGGCCAGG - Intronic
1061795499 9:133083702-133083724 AACCTCCCGGTCCCAGGGCCAGG - Intronic
1061992110 9:134164999-134165021 CACCCGCAGTTCCCGGGGCAGGG - Intergenic
1062004407 9:134232027-134232049 AACCCCCAGCACGCAGGGTCAGG - Intergenic
1062020075 9:134315225-134315247 GACAGCCAGCTCTCGGGGCCAGG - Intergenic
1062056807 9:134473039-134473061 CACCCCCATCTCCAGGGGGCTGG + Intergenic
1185465779 X:353729-353751 AGCCCCCAGCCCCCGGTCCCTGG - Intronic
1185494338 X:543006-543028 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1185596782 X:1312036-1312058 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1185641576 X:1591832-1591854 AAGCCCCGGCCCCCCGGGCCCGG - Intronic
1185685856 X:1927841-1927863 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1185712492 X:2315074-2315096 AACCTCCACCTCCCGGGTTCAGG - Intronic
1185760060 X:2683815-2683837 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1186542309 X:10413086-10413108 AACCTCCATCTCCCGGGTTCAGG + Intergenic
1187160836 X:16763954-16763976 AACCTCCGGCTCCCGGGTTCAGG + Exonic
1187179413 X:16929479-16929501 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1187687906 X:21834222-21834244 AAACCCCAGATCCCAAGGCCAGG - Intergenic
1188209862 X:27409036-27409058 AACCTCCGCCTCCCGGGTCCAGG - Intergenic
1188339191 X:28977879-28977901 AACCTCCACCCCCCGGGTCCTGG - Intronic
1189389537 X:40564238-40564260 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1189786539 X:44563688-44563710 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1189959289 X:46309109-46309131 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1190020497 X:46869689-46869711 AACCCCCGCCTCCCGGGTTCAGG + Intronic
1190117399 X:47635651-47635673 AACCCCCAGGTCCCAAGGCCTGG + Exonic
1190286524 X:48965132-48965154 AACCTCCACCTCCCGGGTTCAGG + Intronic
1190880431 X:54488186-54488208 AACCTCCTCCTCCCGGGTCCTGG - Intronic
1192148075 X:68694941-68694963 TACCCCCAAGTCCCAGGGCCTGG + Intronic
1192564325 X:72151094-72151116 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1193101644 X:77621389-77621411 AACCTCCACCTCCCGGGTTCAGG + Intronic
1193115218 X:77769362-77769384 AACCTCCACCTCCCGAGTCCTGG + Intronic
1193722689 X:85005223-85005245 AACCTCCACCTCCCGGGTTCAGG + Intronic
1194559585 X:95403918-95403940 AACTCCCATCTCCCTGGGACAGG + Intergenic
1194937246 X:99965717-99965739 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1196188688 X:112772390-112772412 AACCTCCGGCTCCCGGGTTCAGG + Intergenic
1196438775 X:115697819-115697841 AACCTCCACCTCCCGGGTCCTGG - Intergenic
1196833992 X:119798176-119798198 AACCTCCACCTCCCGAGTCCCGG - Intergenic
1196882586 X:120212193-120212215 AACCTCCACCTCCCGGGTTCCGG + Intergenic
1196896437 X:120341408-120341430 CACCCCCAGCTCCAGGGCCATGG - Intergenic
1197798437 X:130322717-130322739 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1198206601 X:134471720-134471742 AACCTCCACCTCCCGGGCTCAGG + Intronic
1198374091 X:136020431-136020453 AACCTCCGCCTCCCGGGTCCAGG + Intronic
1198746904 X:139900285-139900307 AACCTCCACCTCCCGGGATCAGG - Intronic
1199096236 X:143743747-143743769 AACCTCCACCTCCCGGGTTCAGG - Intergenic
1199654086 X:149977690-149977712 AACCTCCACCTCCCAGGTCCTGG + Intergenic
1200085493 X:153602413-153602435 AACCTCCACCTCCCGGGTTCAGG + Intergenic
1200086882 X:153611416-153611438 ACCCCCCACCCCCCCGGGCCGGG + Intergenic
1200162732 X:154017712-154017734 AACCTCCACCTCCCGGGTTCAGG - Intronic
1201583628 Y:15536737-15536759 AACCTCCAGCTCCTGGGTTCAGG + Intergenic