ID: 1095810774

View in Genome Browser
Species Human (GRCh38)
Location 12:46371974-46371996
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095810774_1095810784 24 Left 1095810774 12:46371974-46371996 CCTCAAGCACACCCGTCCACAGG 0: 1
1: 0
2: 1
3: 26
4: 145
Right 1095810784 12:46372021-46372043 CGCCCAGCCCCTCCTATGTCCGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095810774 Original CRISPR CCTGTGGACGGGTGTGCTTG AGG (reversed) Intronic