ID: 1095811255

View in Genome Browser
Species Human (GRCh38)
Location 12:46374546-46374568
Sequence CCTCCTTAGCACCTCTAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095811255_1095811263 0 Left 1095811255 12:46374546-46374568 CCCAGTTAGAGGTGCTAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1095811263 12:46374569-46374591 CCCTCAGGGTTGGTAGTTATGGG 0: 1
1: 0
2: 0
3: 3
4: 80
1095811255_1095811260 -10 Left 1095811255 12:46374546-46374568 CCCAGTTAGAGGTGCTAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1095811260 12:46374559-46374581 GCTAAGGAGGCCCTCAGGGTTGG 0: 1
1: 0
2: 0
3: 16
4: 194
1095811255_1095811265 3 Left 1095811255 12:46374546-46374568 CCCAGTTAGAGGTGCTAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1095811265 12:46374572-46374594 TCAGGGTTGGTAGTTATGGGTGG 0: 1
1: 0
2: 1
3: 8
4: 116
1095811255_1095811261 -1 Left 1095811255 12:46374546-46374568 CCCAGTTAGAGGTGCTAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1095811261 12:46374568-46374590 GCCCTCAGGGTTGGTAGTTATGG 0: 1
1: 0
2: 0
3: 3
4: 81
1095811255_1095811266 10 Left 1095811255 12:46374546-46374568 CCCAGTTAGAGGTGCTAAGGAGG 0: 1
1: 0
2: 0
3: 12
4: 102
Right 1095811266 12:46374579-46374601 TGGTAGTTATGGGTGGCAAGTGG 0: 1
1: 0
2: 0
3: 15
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095811255 Original CRISPR CCTCCTTAGCACCTCTAACT GGG (reversed) Intergenic
900745675 1:4359227-4359249 CCTAGAAAGCACCTCTAACTGGG - Intergenic
904876981 1:33662953-33662975 CCTGCATAGCACCTTCAACTCGG - Exonic
906037065 1:42757481-42757503 CCCTCTTGGCACCCCTAACTTGG - Intronic
907274814 1:53311203-53311225 CCTCCTGCGCACCCCTCACTCGG - Intronic
908889533 1:68828557-68828579 CCTCAGAAGCACCTCTTACTTGG - Intergenic
909355250 1:74701117-74701139 CCACCTTAGTAACTCTAACTTGG + Intergenic
909839457 1:80300869-80300891 CCTCCTTAGTGCCTCAAACTAGG + Intergenic
915479001 1:156172477-156172499 CCTCCTTTGCACCTCCAGCAAGG - Intronic
918173733 1:182024534-182024556 CCTCATTACCATCTCTCACTTGG + Intergenic
924266098 1:242284062-242284084 CCTCCTTTCCCCCTCTCACTGGG - Intronic
1063663228 10:8047876-8047898 CCTCCTTTGCACCTCTGAGTCGG + Intergenic
1066718735 10:38314476-38314498 CCTCCTTTCCCCCTCTCACTGGG + Intergenic
1067282214 10:44881117-44881139 CCTCCCTCACACCTCTATCTGGG + Intergenic
1078503380 11:11907427-11907449 CCTCCTTAGAACCCCTATCTTGG - Intronic
1078843488 11:15100890-15100912 CCTCCTTGGCACCCCAAACCTGG + Intergenic
1079108245 11:17588027-17588049 ACTCCTTACCACCTCTGCCTTGG - Intronic
1082977166 11:59084458-59084480 CCTCCTAATCTTCTCTAACTGGG - Intergenic
1083032663 11:59607825-59607847 CCTCCTTATGACTCCTAACTTGG - Intronic
1087291294 11:96323396-96323418 CTTCCTAAGCACCTCTTACATGG - Intronic
1089277089 11:117344612-117344634 CCTCCTTAGCATGTCTAAGTTGG + Intronic
1093441949 12:19209103-19209125 CCTTCTTAGTGCCTCAAACTAGG - Intronic
1095641618 12:44492505-44492527 CCTCCTTATCATGTCTTACTTGG + Intergenic
1095811255 12:46374546-46374568 CCTCCTTAGCACCTCTAACTGGG - Intergenic
1096799381 12:54099618-54099640 ACTCCGTAGCACCTCTCACCTGG + Intergenic
1097684730 12:62680693-62680715 CTTCCTTAGGACCTCTCACATGG - Intronic
1097874982 12:64634843-64634865 CCTTCTTAGTGCCTCAAACTAGG + Intronic
1110591622 13:77269333-77269355 CCTCATTAGCACATTTAAATTGG - Intronic
1111576683 13:90163390-90163412 CCTCCTTAGCTGTTCTAACAAGG - Intergenic
1117714659 14:58568144-58568166 CCTCCTTGGAACGTATAACTAGG + Intergenic
1120711817 14:87800322-87800344 CCTCCTTAGATCCTATAAGTAGG - Intergenic
1137998434 16:53246636-53246658 CCTCCTTAGTAACTAGAACTAGG + Intronic
1139451465 16:67030543-67030565 CCTCATCAGCACCTCCAACAAGG - Intronic
1140944926 16:79758873-79758895 CCTCCTTTGGACTTCTAAGTTGG + Intergenic
1142562213 17:816961-816983 CCTCCTTGGCATCTCCAACTTGG + Intronic
1142728698 17:1835650-1835672 CCTTCTTAGTACCTCAAACTAGG + Intronic
1143895463 17:10132961-10132983 CCTCCCAAGCCCCTCTGACTTGG + Intronic
1148151216 17:45397315-45397337 TTTCCTCAGCTCCTCTAACTGGG + Intronic
1150738617 17:67761453-67761475 CCACCTTAGCACCCCTATCTGGG - Intergenic
1152451670 17:80385369-80385391 CCTCTCTAGCTCCTCAAACTCGG + Intronic
1152556375 17:81055147-81055169 CGTCCTTGACACCTCTAACCTGG - Intronic
1152607933 17:81302424-81302446 CCTCCTGAGCACTGCTTACTGGG + Intergenic
1156255236 18:35388860-35388882 CCTTCTTAGTGCCTCAAACTAGG - Intergenic
1159205686 18:65249065-65249087 CCTTCTTAGAACATCTTACTTGG + Intergenic
1161080915 19:2309723-2309745 CCTCCTTCTCACCCCTCACTTGG - Intronic
1163765795 19:19162638-19162660 CCTCCTTCCCACCTCTCCCTGGG + Intronic
927806053 2:26147666-26147688 CCACCTTAGCACCTCAAGTTAGG - Intergenic
939101699 2:137902048-137902070 TTTCCTTTGCACCTCTAAATGGG - Intergenic
941413440 2:165188670-165188692 CCTCCTGAGTACCTGTACCTGGG - Intronic
946331570 2:219012269-219012291 TCTCATTAGCATCTCAAACTTGG + Intronic
946481282 2:220059220-220059242 CCTCCTCAGCACCTGTAGCTAGG + Intergenic
1170018410 20:11809090-11809112 CCCCCTAAGCATCTCTTACTTGG + Intergenic
1171797050 20:29574722-29574744 ACTCCGTAGCACCTCTCACCTGG - Intergenic
1171851204 20:30309442-30309464 ACTCCGTAGCACCTCTCACCTGG + Intergenic
1174360505 20:50026216-50026238 TCTCCTTAGCACCATTCACTGGG - Intergenic
1175850581 20:62089579-62089601 CCTCCTAAGGACCTCCAAGTGGG + Intergenic
1178152122 21:29807361-29807383 CCTTCTAAGCAACTGTAACTTGG + Intronic
1180143025 21:45904062-45904084 CCTCCTTAGGACCTTCAACCAGG - Intronic
1184301258 22:43562552-43562574 CCTCCCTCCCACCTCTGACTGGG - Intronic
951242158 3:20299741-20299763 CCAACTTAGCTCCTCTAACCTGG + Intergenic
955781109 3:62485745-62485767 CCTCCCTAACACCTATAACAGGG - Intronic
956045963 3:65196169-65196191 CCTCCTTTCCTCCTCTGACTTGG + Intergenic
956952176 3:74295467-74295489 CCTCCCTTGCACCTCTTTCTTGG + Intronic
960436503 3:117633396-117633418 TTTCCTTAACACTTCTAACTTGG - Intergenic
961032864 3:123621853-123621875 CCTCCTCATCACCTCCACCTGGG - Intronic
961863761 3:129938668-129938690 CCTCCTGAGCACCTCCACCTGGG + Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
975219547 4:71798578-71798600 GTTCCCAAGCACCTCTAACTGGG + Intronic
975717784 4:77221786-77221808 CCTCCTTAACAACTCCAAGTAGG + Intronic
976893158 4:90075383-90075405 TCTCCTTAGCAAGTCTTACTGGG - Intergenic
977748313 4:100578316-100578338 CCTCGTTAGAACCTCTCCCTAGG + Intronic
977917197 4:102607487-102607509 CTTGCTTGGCATCTCTAACTGGG + Intronic
978239983 4:106503813-106503835 CCTCCTTAGACTTTCTAACTGGG - Intergenic
981031024 4:140126074-140126096 CCTCTTTAACACCTGTACCTTGG - Intronic
986741399 5:10708797-10708819 TGTTCTCAGCACCTCTAACTAGG + Intronic
990451178 5:55933011-55933033 CCTCCTTCGCATCTCAAACCTGG - Intergenic
990534050 5:56702499-56702521 CCTCCTTACCTCCTCTCCCTAGG - Intergenic
992136100 5:73747629-73747651 CTTCCATAGCATCTTTAACTGGG + Intronic
992466844 5:77014582-77014604 GCTCTTTAGCAGTTCTAACTAGG - Intergenic
998068861 5:139180876-139180898 TCTCCATAGCTCCTCTAGCTAGG + Intronic
998616605 5:143747665-143747687 CCTCATTAGCCCATTTAACTTGG - Intergenic
1000742006 5:164979993-164980015 CCTCCTTAACTCCCCTAACATGG + Intergenic
1002402539 5:178999193-178999215 CCTCCATAGACCCTCTGACTGGG + Intergenic
1003934867 6:10965209-10965231 CCTGCTTAGAACCACCAACTTGG - Intronic
1005072102 6:21871512-21871534 CCTGATTAGCACCTCTTCCTAGG + Intergenic
1006861594 6:37175062-37175084 CCTCCTTTCCTCCTCTGACTTGG + Exonic
1007022187 6:38532024-38532046 CCTCTTTAGCACCTCTTTCAGGG - Intronic
1008067929 6:47070344-47070366 CTTCCTTAATACCTATAACTAGG + Intergenic
1008517474 6:52331820-52331842 CATCCTTAGAAACTCTACCTGGG - Intergenic
1012225632 6:96700281-96700303 CCTCCTAAGGACCTTCAACTCGG + Intergenic
1013414354 6:109911744-109911766 CCTCCTTCCCACCTCTACCATGG - Intergenic
1023614632 7:42007194-42007216 CCTCCTTAGCATCATTATCTTGG - Intronic
1028597652 7:92563646-92563668 CCTCATTAACAGCTCTACCTGGG + Intronic
1029866626 7:103638308-103638330 CCTCATTAGCATCTCTAACAGGG + Intronic
1032304165 7:130716903-130716925 CCTCCTTAGCCCCTCACAGTGGG - Intergenic
1033409646 7:141105643-141105665 CATCTTTAGCAGCTCGAACTTGG - Intronic
1039802487 8:40971574-40971596 CCTTCTTAGTGCCTCAAACTAGG - Intergenic
1055433293 9:76266971-76266993 CCTTATTAGCACCTCTGAATGGG - Intronic
1055690053 9:78820357-78820379 CCTCATTAGAACCTCTAAGGAGG + Intergenic
1057282994 9:93726250-93726272 CCTCCTGAACACCCCTACCTGGG - Intergenic
1058675021 9:107392922-107392944 CTTCCTTAGCATCTCTCACCTGG + Intergenic
1058876334 9:109248219-109248241 CCTCCTGAGCATCTCCCACTGGG + Intronic
1059694245 9:116715755-116715777 CCTCCTTAGCACCTCATATTAGG + Intronic
1060718433 9:125956337-125956359 TCTCCTTAGAATCTCTGACTTGG - Intronic
1186256870 X:7731261-7731283 CCTCCCTAGCAGCTGGAACTAGG + Intergenic
1187924619 X:24238550-24238572 CCCTCTTATCACCCCTAACTTGG + Intergenic
1187977908 X:24722422-24722444 GCTACTTAGGACATCTAACTAGG - Intronic
1188943803 X:36271684-36271706 CCTACTTAGAATCTCAAACTAGG - Intronic
1190707287 X:53040699-53040721 CATCCCTAGCACCTGTATCTTGG + Intergenic
1191116996 X:56863055-56863077 GCTCCTTAGTAACTCTAACAGGG - Intergenic
1196275033 X:113756728-113756750 CCTCTTTAGCACCTCATTCTAGG + Intergenic
1196744956 X:119063321-119063343 CCTCCCTACCACCCCTCACTGGG + Intergenic
1197795135 X:130290236-130290258 CCTCTTTATCACCTTTAAATTGG - Intergenic
1199736157 X:150688562-150688584 GCTCCTTGTCACCTCTAACAGGG + Intergenic
1200024891 X:153249631-153249653 CCTCCTTAGCAGTTTTAACACGG + Intergenic
1200307802 X:155046148-155046170 CCTCCTTGCCATCTCTACCTCGG + Intronic