ID: 1095814536

View in Genome Browser
Species Human (GRCh38)
Location 12:46406985-46407007
Sequence AAGTGGGTGGGGAGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095814536_1095814544 2 Left 1095814536 12:46406985-46407007 CCATCTTCCCTCCCCACCCACTT No data
Right 1095814544 12:46407010-46407032 ACATGTCTAGACCCCTCCACTGG No data
1095814536_1095814547 12 Left 1095814536 12:46406985-46407007 CCATCTTCCCTCCCCACCCACTT No data
Right 1095814547 12:46407020-46407042 ACCCCTCCACTGGGGAAGATAGG No data
1095814536_1095814549 13 Left 1095814536 12:46406985-46407007 CCATCTTCCCTCCCCACCCACTT No data
Right 1095814549 12:46407021-46407043 CCCCTCCACTGGGGAAGATAGGG No data
1095814536_1095814546 4 Left 1095814536 12:46406985-46407007 CCATCTTCCCTCCCCACCCACTT No data
Right 1095814546 12:46407012-46407034 ATGTCTAGACCCCTCCACTGGGG No data
1095814536_1095814545 3 Left 1095814536 12:46406985-46407007 CCATCTTCCCTCCCCACCCACTT No data
Right 1095814545 12:46407011-46407033 CATGTCTAGACCCCTCCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095814536 Original CRISPR AAGTGGGTGGGGAGGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr