ID: 1095815431

View in Genome Browser
Species Human (GRCh38)
Location 12:46417052-46417074
Sequence CCTGGGAAGCAGAAGTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095815431_1095815437 17 Left 1095815431 12:46417052-46417074 CCTTGCAACTTCTGCTTCCCAGG No data
Right 1095815437 12:46417092-46417114 CCTCAGCCTCCCGAGTAGTTGGG 0: 2088
1: 109541
2: 293907
3: 224023
4: 127703
1095815431_1095815439 25 Left 1095815431 12:46417052-46417074 CCTTGCAACTTCTGCTTCCCAGG No data
Right 1095815439 12:46417100-46417122 TCCCGAGTAGTTGGGACTACAGG 0: 916
1: 59664
2: 183553
3: 269452
4: 191134
1095815431_1095815435 16 Left 1095815431 12:46417052-46417074 CCTTGCAACTTCTGCTTCCCAGG No data
Right 1095815435 12:46417091-46417113 GCCTCAGCCTCCCGAGTAGTTGG 0: 2007
1: 103450
2: 266444
3: 217910
4: 137507

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095815431 Original CRISPR CCTGGGAAGCAGAAGTTGCA AGG (reversed) Intergenic
No off target data available for this crispr