ID: 1095819302

View in Genome Browser
Species Human (GRCh38)
Location 12:46460031-46460053
Sequence GGACACTTTCTAGCCAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095819297_1095819302 20 Left 1095819297 12:46459988-46460010 CCTGGATACAAATCCTTGGTCTT No data
Right 1095819302 12:46460031-46460053 GGACACTTTCTAGCCAAAAGTGG No data
1095819298_1095819302 7 Left 1095819298 12:46460001-46460023 CCTTGGTCTTAAGTTCTCTTTTC No data
Right 1095819302 12:46460031-46460053 GGACACTTTCTAGCCAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095819302 Original CRISPR GGACACTTTCTAGCCAAAAG TGG Intergenic
No off target data available for this crispr