ID: 1095825161

View in Genome Browser
Species Human (GRCh38)
Location 12:46523538-46523560
Sequence GGTGGGACTAAGAATTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095825161_1095825171 26 Left 1095825161 12:46523538-46523560 CCTCTATAATTCTTAGTCCCACC No data
Right 1095825171 12:46523587-46523609 TTAGGATGTTGGCCCCTCCCAGG No data
1095825161_1095825172 29 Left 1095825161 12:46523538-46523560 CCTCTATAATTCTTAGTCCCACC No data
Right 1095825172 12:46523590-46523612 GGATGTTGGCCCCTCCCAGGAGG No data
1095825161_1095825170 15 Left 1095825161 12:46523538-46523560 CCTCTATAATTCTTAGTCCCACC No data
Right 1095825170 12:46523576-46523598 GGTTTACGGCATTAGGATGTTGG No data
1095825161_1095825167 1 Left 1095825161 12:46523538-46523560 CCTCTATAATTCTTAGTCCCACC No data
Right 1095825167 12:46523562-46523584 TGGACATCCTTGTTGGTTTACGG No data
1095825161_1095825164 -6 Left 1095825161 12:46523538-46523560 CCTCTATAATTCTTAGTCCCACC No data
Right 1095825164 12:46523555-46523577 CCCACCTTGGACATCCTTGTTGG No data
1095825161_1095825173 30 Left 1095825161 12:46523538-46523560 CCTCTATAATTCTTAGTCCCACC No data
Right 1095825173 12:46523591-46523613 GATGTTGGCCCCTCCCAGGAGGG No data
1095825161_1095825169 8 Left 1095825161 12:46523538-46523560 CCTCTATAATTCTTAGTCCCACC No data
Right 1095825169 12:46523569-46523591 CCTTGTTGGTTTACGGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095825161 Original CRISPR GGTGGGACTAAGAATTATAG AGG (reversed) Intergenic
No off target data available for this crispr