ID: 1095825788

View in Genome Browser
Species Human (GRCh38)
Location 12:46530313-46530335
Sequence GTGATAGCAGTGGCCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095825788_1095825798 4 Left 1095825788 12:46530313-46530335 CCTGGAGAGGCCACTGCTATCAC No data
Right 1095825798 12:46530340-46530362 GTGGCTGCAGGGAGGGCACGGGG No data
1095825788_1095825800 10 Left 1095825788 12:46530313-46530335 CCTGGAGAGGCCACTGCTATCAC No data
Right 1095825800 12:46530346-46530368 GCAGGGAGGGCACGGGGAGGTGG No data
1095825788_1095825797 3 Left 1095825788 12:46530313-46530335 CCTGGAGAGGCCACTGCTATCAC No data
Right 1095825797 12:46530339-46530361 AGTGGCTGCAGGGAGGGCACGGG No data
1095825788_1095825794 -3 Left 1095825788 12:46530313-46530335 CCTGGAGAGGCCACTGCTATCAC No data
Right 1095825794 12:46530333-46530355 CACACCAGTGGCTGCAGGGAGGG No data
1095825788_1095825791 -8 Left 1095825788 12:46530313-46530335 CCTGGAGAGGCCACTGCTATCAC No data
Right 1095825791 12:46530328-46530350 GCTATCACACCAGTGGCTGCAGG No data
1095825788_1095825792 -7 Left 1095825788 12:46530313-46530335 CCTGGAGAGGCCACTGCTATCAC No data
Right 1095825792 12:46530329-46530351 CTATCACACCAGTGGCTGCAGGG No data
1095825788_1095825793 -4 Left 1095825788 12:46530313-46530335 CCTGGAGAGGCCACTGCTATCAC No data
Right 1095825793 12:46530332-46530354 TCACACCAGTGGCTGCAGGGAGG No data
1095825788_1095825799 7 Left 1095825788 12:46530313-46530335 CCTGGAGAGGCCACTGCTATCAC No data
Right 1095825799 12:46530343-46530365 GCTGCAGGGAGGGCACGGGGAGG No data
1095825788_1095825796 2 Left 1095825788 12:46530313-46530335 CCTGGAGAGGCCACTGCTATCAC No data
Right 1095825796 12:46530338-46530360 CAGTGGCTGCAGGGAGGGCACGG 0: 2
1: 3
2: 7
3: 123
4: 906
1095825788_1095825801 13 Left 1095825788 12:46530313-46530335 CCTGGAGAGGCCACTGCTATCAC No data
Right 1095825801 12:46530349-46530371 GGGAGGGCACGGGGAGGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095825788 Original CRISPR GTGATAGCAGTGGCCTCTCC AGG (reversed) Intergenic
No off target data available for this crispr