ID: 1095825792

View in Genome Browser
Species Human (GRCh38)
Location 12:46530329-46530351
Sequence CTATCACACCAGTGGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095825788_1095825792 -7 Left 1095825788 12:46530313-46530335 CCTGGAGAGGCCACTGCTATCAC No data
Right 1095825792 12:46530329-46530351 CTATCACACCAGTGGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095825792 Original CRISPR CTATCACACCAGTGGCTGCA GGG Intergenic
No off target data available for this crispr